Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Cow NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Vector DNA was dephosphorylated using quick cow intestinal phosphatase (QCIP) and ligation reactions conducted using T7 DNA ligase (NEB). Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Microbiology 2023Quote: ... and HindIII (New England Biolabs, Ipswich, MT, USA) at 37°C for one hour ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ΔMTS mtSSB was combined with 4.7 nM M13mp18 ssDNA (NEB, N4040S) at ratios calculated with the following equation ...
-
bioRxiv - Immunology 2021Quote: VH and VL sequences of candidate sequences were cloned into a pcDNA.3 based vector with dual CMV promotor harboring IgG1 heavy chain and light chain backbone using NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... and the V regions were inserted into cut backbone vectors (heavy chain: FJ475055; kappa chain: FJ75056) via Gibson reaction (New England Biolabs). Successful clones were prepared ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Polymerase chain reaction (PCR) products and plasmids were purified using Monarch® PCR & DNA Cleanup Kit (New England Biolabs) and Sanger sequencing was performed by Eurofins Genomics ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA was isolated from the supernatant using the polymerase chain reaction (PCR) clean-up kit (New England Biolabs®) and quantified using a nanodrop ...
-
bioRxiv - Pathology 2021Quote: Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (NEB). Two gene targets were used for SARS-CoV-2 RNA detection ...
-
bioRxiv - Immunology 2022Quote: Fab fragments were generated by inserting a stop codon six amino acids upstream of the hinge region (CPPCP) of the heavy chain expression plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). This mutagenized plasmid was co-transfected with the respective light chain plasmid ...
-
bioRxiv - Immunology 2022Quote: ... and Illumina linker addition to B cell heavy chain transcripts were performed using the human NEBNext Immune Sequencing Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... which underwent a restriction enzyme digest with XbaI (New England Biolabs, Ipswich, MT, USA) and HindIII (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... according to the manufacturer’s instructions.29 RNA reverse transcription and first strand cDNA synthesis were carried out using chain-specific reverse primers30 with ProtoScript® II First Strand cDNA Synthesis Kit (NEB). The resulting cDNA was used as template for preparing the sequencing library using 5’ multiplex PCR as previously described.31 The PCR products corresponding to the library amplification were purified on BluePippin with size cutoff around 500 bp ...
-
bioRxiv - Microbiology 2023Quote: RNA was used as template to detect and quantify viral genomes by duplex reverse transcriptase (RT) quantitative polymerase chain reaction (RT-qPCR) using a Luna Universal Probe one-step RT-qPCR kit (New England Biolabs, E3006E). SARS-CoV-2-specific RNAs were detected by targeting the ORF1ab gene using the following set of primers and probes ...
-
bioRxiv - Microbiology 2022Quote: ... the template chain was digested using DpnI restriction endonuclease (NEB, USA). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Microbiology 2022Quote: ... Reverse-transcription polymerase chain reaction (RT-PCR) was performed using the Luna Universal Probe One-Step RT-qPCR kit (New England BioLabs; https://www.neb.ca). The 5 ‘ untranslated region (UTR ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Complementary DNA (cDNA) was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (NEB, Ipswich, MA). Transcript levels were measured by real time PCR using SYBR green on an ABI 7500 system ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB, Ipswich, MA). pSMART-HC-Kan (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Immunology 2023Quote: ... was generated by reverse transcriptase polymerase chain reaction (PCR) using the ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Transcript levels were measured by real time PCR using SYBR green on an ABI 7500 system ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...