Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for Cow Flotillin 2 FLOT2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... Vector DNA was dephosphorylated using quick cow intestinal phosphatase (QCIP) and ligation reactions conducted using T7 DNA ligase (NEB). Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... gigas β/δ82Asn→Lys Hb mutant via site-directed mutagenesis on the Steller’s sea cow Hb expression vector by whole plasmid amplification using mutagenic primers and Phusion High-Fidelity DNA Polymerase (New England BioLabs), phosphorylation with T4 Polynucleotide Kinase (New England BioLabs) ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Developmental Biology 2019Quote: Pacy-2::acy-2 genomic was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Microbiology 2019Quote: ... (2) DSBs blunting with NEB’s Quick Blunting Kit (NEB, cat. number: E1201); (3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Microbiology 2021Quote: ... was utilized using SARS-CoV-2 specific primers[43] or SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs), which became available in assays after September 15 ...
-
bioRxiv - Microbiology 2022Quote: ... human NINL isoform 2 (NCBI accession NM_001318226.2) and the NINL isoform 2 mutant (Q231R) were mutagenized using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The plasmids encoding 3C proteases (coxsackievirus B3 (CVB3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... amplified with the primers Dhm1275-1 and −2 (Table 2) using a NEBuilder HiFi DNA Assembly Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... 2 µL of Taq DNA polymerase (LongAmp Taq DNA Polymerase kit, New England Biolabs), 7.5 µL of dNTPs (dNTP set ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2(genomic) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Cell Biology 2020Quote: The pIGLR-2∷mCherry construct was generated with a Gibson assembly cloning kit (NEB) with the following four fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... or NEBNext Ultra II DNA Library Prep Kit for Illumina (replicate 2: NEB, E7645S), according to the manufacturers’ protocols ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μL T7 RNA Polymerase mix (HiScribe T7 High Yield RNA Synthesis Kit, NEB) were incubated at 37°C for 3 h ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the NEBNext ARTIC SARS-CoV-2 Library Prep Kit (NEB) and ARTIC V3 (MHome ...
-
bioRxiv - Microbiology 2022Quote: ... and library preparation was performed using the NEBNext ARTIC SARS-CoV-2 FS kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Purified round 2 PCR products were cloned using the NEB PCR Cloning Kit (NEB, #E1202) and sequenced with Sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... 2 μL GlycoBuffer 2 10X (NEB), 2 μL NP-40 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment(anti-sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...
-
bioRxiv - Microbiology 2022Quote: ... a sequencing library was constructed with the NEBNext ARTIC SARS-CoV-2 FS kit (NEB E7658S). For each viral variant ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized from 2 μg RNA using the ProtoScript II First Strand cDNA Synthesis Kit (NEB) per manufacture’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA from 2 biological replicates was purified with Monarch PCR & DNA Cleanup Kit (Cat. no. T1030, NEB). Library preparation ...
-
bioRxiv - Genetics 2020Quote: ... corresponding to the point mutation in the SARS-CoV-2 genome (Q5 Site-directed mutagenesis kit, NEB). Site directed mutagenesis primers (Table S1 ...
-
bioRxiv - Cancer Biology 2021Quote: Libraries were prepared using the NEBNext Ultra 2 DNA Library Preparation Kit (New England Biolabs, MA, USA) with AMPure® XP Beads (Beckman Coulter ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μg of total RNA was converted into cDNA with LunaScript RT SuperMix kit (New England Biolabs). The cDNAs were used as templates for real-time PCR and ran on StepOnePlus real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using the Luna® SARS-CoV-2 RT-qPCR Multiplex Assay Kit (NEB) with the CDC-derived primers for N1 and N2 gene targets and the reaction was performed using the QuantStudio™ 5 System (ThermoFisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was isolated from ∼2×106 cells using the Monarch DNA purification Kit (New England Biolabs). For genotyping ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... poly(A) RNA (2-5 ng) was converted to cDNA using the Protoscript II kit (New England Biolabs) and a supplied mix of random hexamer and d(T)23VN primers ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNA was synthesized on 2 µg of total RNA using ProtoScript II First Strand cDNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified using the Luna Universal Probe Onestep RT-qPCR kit (New England Biolabs) and US CDC real-time RT-PCR primer/probe sets for 2019-nCoV_N1 ...
-
bioRxiv - Developmental Biology 2019Quote: Pceh-23_L::acy-2 fragment (sense/anti-sense) Pceh-23_L::acy-2 fragment(sense) was generated with a Gibson assembly cloning kit (NEB) by assembly of the following two DNA fragments ...