Labshake search
Citations for New England Biolabs :
1 - 9 of 9 citations for Complement anaphylatoxin C5a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Mutagenesis of complement templates was performed using the Q5 Mutagenesis kit (NEB) with primers referenced in the primer table S1.
-
bioRxiv - Microbiology 2019Quote: ... The gltA complement plasmid was constructed using a Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then subjected to a primer extension reaction with dUTP to separate the nascent strand from its complement (1X NEB buffer2 ...
-
bioRxiv - Biochemistry 2019Quote: ... encoding the reverse complement of the Illumina Read1 primer binding site (R1R) using Thermostable 5’ AppDNA/RNA Ligase (New England Biolabs). Ligated cDNAs were re-purified with MinElute Reaction Cleanup Kit and amplified by PCR for 12 cycles using Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Microbiology 2023Quote: ... and complement strains (wos2Δ::WOS2) were constructed using biolistic transformation of constructs amplified using double-joint PCR or Gibson Assembly (NEB), as previously described (primers ...
-
bioRxiv - Microbiology 2023Quote: ... AvcI RNA was synthesized by in vitro transcription using the T7-AvcI reverse complement DNA template and the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB™). Bio-11-UTP was included during the transcription reaction for Northern blot detection purposes ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...