Labshake search
Citations for New England Biolabs :
1 - 50 of 234 citations for Complement Factor B CFB Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Mutagenesis of complement templates was performed using the Q5 Mutagenesis kit (NEB) with primers referenced in the primer table S1.
-
bioRxiv - Biophysics 2022Quote: ... 1 µL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL factor mix (NEB), 250 nM pre-incubated 50S ribosomal subunits ...
-
bioRxiv - Microbiology 2019Quote: ... The gltA complement plasmid was constructed using a Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Biophysics 2020Quote: ... Factor Xa protease (New England Biolabs) was added to the MT solution at a molar ratio of 1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Factor Xa (P8010S, New England BioLabs) or TEV protease (P8112S ...
-
bioRxiv - Biochemistry 2023Quote: ... 20 µg factor Xa protease (NEB) and 5 mM CaCl2 with inversion at 10 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... and a “bottom” strand with sequence 5’-AAAAC-(30bp spacer reverse complement)-3’ were phosphorylated with PNK (NEB, M0201S) in a 50 μL reaction volume (1.5 μL 100 uM top oligo ...
-
bioRxiv - Cell Biology 2021Quote: All dox-inducible factors were generated by cloning the open reading frame of each factor into the pMINI vector (NEB) and then restricted with EcoRI or MfeI and inserted into the FUW-TetO expression vector ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA was then subjected to a primer extension reaction with dUTP to separate the nascent strand from its complement (1X NEB buffer2 ...
-
bioRxiv - Biochemistry 2019Quote: ... encoding the reverse complement of the Illumina Read1 primer binding site (R1R) using Thermostable 5’ AppDNA/RNA Ligase (New England Biolabs). Ligated cDNAs were re-purified with MinElute Reaction Cleanup Kit and amplified by PCR for 12 cycles using Phusion DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... pJR98 was digested by AscI and ssDNA oligo donors of the sequence 5’ CTCTTCCTGCCCGACCTTGGGG – reverse complement IBC – CAGCGCCATAGCTGAGTGTAGATTCGAGC – 3’ were cloned into the vector using NEBuilder HiFI DNA Assembly Master Mix (NEB). Third ...
-
bioRxiv - Microbiology 2023Quote: ... and complement strains (wos2Δ::WOS2) were constructed using biolistic transformation of constructs amplified using double-joint PCR or Gibson Assembly (NEB), as previously described (primers ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Biophysics 2021Quote: ... coli B ER2566 from NEB; ampicillin ...
-
bioRxiv - Microbiology 2019Quote: ... 7.5 μL solution B (NEB #E6800), 2 μL E ...
-
bioRxiv - Microbiology 2023Quote: ... AvcI RNA was synthesized by in vitro transcription using the T7-AvcI reverse complement DNA template and the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB™). Bio-11-UTP was included during the transcription reaction for Northern blot detection purposes ...
-
bioRxiv - Genetics 2023Quote: ... 100 pmol of template oligos and 125 pmol IRDye 700-labeled reverse complement primer F1 were mixed in Phusion® High-Fidelity PCR Master Mix (NEB, Ipswich, MA). A 15s denaturing at 95°C following a 10-minute extension at 52°C afforded duplex DNAs ...
-
bioRxiv - Microbiology 2020Quote: ... the resin was treated with factor Xa protease (P8010L, NEB) overnight at 4°C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... the MPB tag was cleaved overnight using Factor Xa (NEB) in dialysis buffer and loaded again on an MBP-Trap HP column ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Barcode cassette was amplified from genomic DNA with primers P5.seq-B-GLI.v1 and P7.seq-B-GLI.v1 using OneTaq® DNA Polymerase (NEB, cat ...
-
bioRxiv - Biochemistry 2021Quote: ... MBP was cleaved from LH using Factor Xa (New England Biolabs) at a w/w ratio of 1% Factor Xa:LH ...
-
bioRxiv - Biochemistry 2021Quote: ... bovine RNase B and fetuin (New England Biolabs) by PNGase F (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... B are ligated first by T4 DNA ligase (NEB) in 40μl system ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Microbiology 2020Quote: ... Appropriate fractions were pooled and digested with factor Xa protease (New England Biolabs) in the presence of 2 mM CaCl2 at 4 °C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... 125 to 75 U/ 5 μg RNase B (Cat.P7817S, NEB) and fetuin (Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9 protein (IDT) was suspended with a Diluent B (NEB) to make 1 μM solution ...
-
bioRxiv - Cell Biology 2023Quote: ... the column was loaded with 80 units of Factor Xa (New England Biolabs, P8010) in cleavage buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Biochemistry 2022Quote: ... RNase B from bovine pancreas (New England Biolabs, Ipswich MA, USA), and horse radish peroxidase (HRP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the PURExpress® kit containing Solution A and Solution B (NEB) was used to prepare the transcription-translation reaction ...
-
bioRxiv - Microbiology 2024Quote: ... coli B strain was dephosphorylated with 0.4 U/µL QuickCIP (NEB) in 1 x rCutSmart buffer (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... Then CaCl2 was added to 2mM and 1 µL (about 1 µg) of Factor Xa (NEB) was added per 50 µg of protein and the samples were left at RT for 20-24h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Genetics 2019Quote: ... The ligation reaction mixture B consisted of appropriate amount of T3 ligase (NEB) with ligation buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Cas9 was diluted to 7 μM with diluent buffer B (NEB, Ipswich USA) on arrival and stored at −20 °C ...
-
bioRxiv - Cancer Biology 2019Quote: Purified hTERT_191-306 proteins were incubated with CDK1-cyclin B (New England Biolabs) or purified IKK2_2-664 proteins ...
-
bioRxiv - Cell Biology 2022Quote: ... B and C oligonucleotides were phosphorylated with T4 polynucleotide kinase (NEB, Cat #M0201L) according to the manufacturer recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... The glutathione S-transferase (GST) tag was cleaved using Factor Xa Protease (New England Biolabs, Ipswich, MA, USA) in accordance with the manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2021Quote: ... for 12 h at 4 °C with 10 μg of Factor Xa protease (New England Biolabs, Hitchin, UK) per 1 g of mitochondria ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HDR enhancing factors and MS2 tag were cloned between Esp3I sites by Golden Gate Assembly (New England Biolabs). All the primers are listed in Supplementary Table 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... The pet30-B vector was digested with Nde1 (R0111, New England BioLabs, Waltham, MA) and EcoRI-HF (R3101 New England BioLabs ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNAs encoding human elongation factor eEF2 were amplified by PCR using Q5 High-Fidelity 2X Master Mix (NEB) with primers (forward primer ...
-
bioRxiv - Genetics 2020Quote: ... 2.5 μL of Taq Buffer B (Mg-free; 10X) (New England Biolabs, Ipswich, MA, USA), 2.5 μL of dNTPs (2.5 mM of each base) ...
-
bioRxiv - Bioengineering 2023Quote: These inserts were then cloned into the pSECRETS-B cassette via USER cloning (NEB #M5505S). To maintain library diversity ...
-
bioRxiv - Biochemistry 2022Quote: 30 uL of tagged Fluc-WT proteins were incubated with Factor Xa (NEW ENGLAND BioLabs, final concentration 67 ug/mL) for 2 hours or overnight on ice.