Labshake search
Citations for New England Biolabs :
1 - 50 of 3616 citations for Chitinase 3 Like Protein 2 CHI3L2 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The digested pGRG36 and cloned chitinase gene were ligated together using ElectroLigase (New England Biolabs) and used to transform One Shot Electrocompetent cells ...
-
bioRxiv - Biochemistry 2023Quote: ... or β-N-acetylhexosaminidases (jack bean from Sigma-Aldrich, Streptomyces plicatus chitinase from New England Biolabs or in-house-produced recombinant Caenorhabditis elegans HEX-4 specific for β1,4-GalNAc-linked residues ...
-
bioRxiv - Microbiology 2021Quote: ... Chitinase genes and their endogenous promoters were amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with wild-type Salmonella IR715 as the template and the primer sets STM0233_Tn7Com_FW and STM0233_Tn7Com_RV or chiA_Tn7Com_FW and chiA_Tn7Com_RV ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies (Anti-3-hydroxybutyryllysine [PTM Biolabs 1201] ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µL of Lambda Protein Phosphatase (NEB, P0753S) was added to aliquots 3 and 4 (PPase only) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 µL of λ protein phosphatase (NEB P0753S) was added and incubated at 37°C for 30 minutes and then placed on ice ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... α2-3,6,8 neuraminidase (New England Biolabs, 25 U/μg protein) and α-N-acetyl-galactosaminidase (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μL of lambda protein phosphatase (NEB, Catalog #P0753S) were added to the washed FRQ-coupled V5 resin ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2) 7 µL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per slide was added for deglycosylation and incubated overnight at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 2.5 μL 10 mM MnCl2 and 2 μL Lambda Protein Phosphatase (NEB). The dephosphorylation reaction was allowed to occur at 30 °C overnight ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... The diluted sample was treated with 2 µl Lambda protein phosphatase (NEB) and incubated in water bath at 30 °C for 4 hrs ...
-
bioRxiv - Cell Biology 2019Quote: ... The bead-bound protein was incubated with 3 µM SNAP-Surface Alexa Fluor 647 (NEB) for 40-60 min at 4°C (to fluorescently label the protein) ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were detected using anti-MBP antibody (anti-MBP NEB e8032s) and HRP conjugated secondary antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... and (MBP)2-HSPC300 proteins were purified through amylose beads (New England Biolabs). The Sra1/Nap1 dimer was obtained by co-expressing His6-Sra1 and untagged Nap1 in Tni insect cells (Expression Systems) ...
-
bioRxiv - Plant Biology 2022Quote: ... the acquired Mlathy INR and INR-like sequences were confirmed by PCR using the Q5 Hot Start High-Fidelity kit (NEB), enzymatic clean-up using ExoSAP-IT™ (Thermo Fisher scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...