Labshake search
Citations for New England Biolabs :
1 - 50 of 940 citations for Chikungunya Virus E1 Envelope Protein HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The time between nuclear envelope breakdown (NEB) and anaphase onset (AO ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells undergoing mitosis were tracked from nuclear envelope breakdown (NEB) to anaphase onset ...
-
bioRxiv - Cell Biology 2020Quote: ... Mitotic duration was defined as the time from nuclear envelope breakdown (NEB) until division ...
-
bioRxiv - Cell Biology 2019Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB), which could be determined in our movies by adjusting the contrast to visualise when the cytoplasmic pool of the fluorescent protein was first observed to enter into the nucleus.
-
bioRxiv - Cell Biology 2022Quote: ... Entry into mitosis was taken as the time of nuclear envelope breakdown (NEB).
-
bioRxiv - Cell Biology 2019Quote: ... The time taken for each cell to progress from nuclear envelope breakdown (NEB) to anaphase onset (chromatid separation ...
-
bioRxiv - Immunology 2022Quote: HIV envelope plasmids were transformed and amplified in NEB-stable competent cells (NEB, C3040H). Pseudoviruses were produced by co-transfection of plasmids encoding various HIV-1 Envs together with NL4-3 ΔEnv or Q23-ΔEnv (1:3 ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Once PCNA foci disappear the G2 phase starts and lasts until nuclear envelope breakdown (NEB). After apical mitosis ...
-
bioRxiv - Molecular Biology 2023Quote: ... is inserted in n-terminal of E2 protein of CHIKV 181/25 structural genes (C-E3-E2-6K-E1) and cloned into pcDNA3.1(+) expression vector using gibson assembly cloning kit (NEB, USA). The resulting plasmid is designated as ChAC-VLP ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... only centriolar pairs that could be tracked from the beginning of nuclear cycle 12 until nuclear envelope breakdown (NEB) (for Sas-6)/beginning of nuclear cycle 13 (for Ana2)/throughout the entire detection window of the oscillation (for Plk4 ...
-
bioRxiv - Cell Biology 2023Quote: ... Envelope gene mutations were introduced into WT cDNA sequence using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). All cloned were sequenced (Eurofins).
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cDNA was then used as template to amplify the envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). Nested PCRs were performed ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Immunology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). First round primers consisted of forward primer VIF2 (5’ – GGGTTTATTACAGAGACAGCAGAG – 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... into cDNA which was used in two-round nested PCR for amplification of envelope gene using High Fidelity Phusion DNA Polymerase (New England Biolabs). The envelope amplicons were purified ...
-
bioRxiv - Cell Biology 2022Quote: Cytokinetic furrowing rate measurements for both the P0 cell and the AB cell were taken relative to nuclear envelope breakdown (NEB). For all analyses ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...
-
bioRxiv - Microbiology 2021Quote: ... Virus stocks were recovered following linearization of infectious clone plasmids using NotI-HF (NEB), in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... The virus lysate was then denatured by boiling in denaturing buffer (New England BioLabs) for 10 min and treated with PNGase F or Endo Hf enzymes (New England BioLabs ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs). Regularly ...
-
bioRxiv - Biophysics 2020Quote: The transient transfection of HEK293 cells was performed67 using the TransFectin Lipid Reagent (Bio-Rad) (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Cat. #E7770) or NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (#E7760) ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: Virus-encoding plasmids were generated using Gibson Assembly (NEB Gibson Assembly kit, NEB, Ipswich, MA). Insert amplicons containing 25 bp overlaps to target regions were generated using Kapa HiFi Hotstart™ high-fidelity polymerase (Kapa Biosystems/Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: Virus stocks were generated by either transfecting purified in vitro transcribed viral RNA (HiScribe, NEB) or transfecting the infectious cDNA clone containing plasmid in BHK-T7 cells ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Cell Biology 2024Quote: ... RNA was reverse transcribed with Moloney murine leukemia virus (M-MuLV) transcriptase (New England Biolabs). The purity and concentration of RNA were measured using NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the enzymatic activity of the commerically availablale recombinant vaccinia virus methyltransferase mRNA 2’O-methyltransferase (NEB), abbreviated hereagter as VMTR1 ...
-
bioRxiv - Microbiology 2023Quote: ... cell and virus particle lysates were treated with PNGase F and Endo Hf (New England Biolabs) following the manufacturer’s protocol for 1 hour at 37°C prior to Western blotting.
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK293 cell suspensions (1×106/100 μL) were treated with DNAse I (0.2 U/μL, NEB M0303S; NEB DNaseI buffer) or Benzonase (25 U/μL ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Genetics 2019Quote: ... The 3′-UTR sequences of both genes were then amplified from genomic DNA obtained from HEK293 cells with Phusion® High-Fidelity DNA Polymerases (NEB, Ipswich, MA) and cloned into the multiple cloning site of the pMIR-REPORT luciferase miRNA expression vector (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... in the 5’end of 30 mer RNA substrate we used the vaccinia virus capping enzyme following the manufacturer’s protocol (New England Biolabs), except that the methyl donor SAM was absent and 0.05 units of inorganic pyrophosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Microbiology 2024Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2L-O-methyltransferase (New England Biolabs). The mRNA was purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids encoding HA-tagged LC3B proteins were generated by replacing the EGFP sequence in the EGFP plasmids with an HA-tag followed by a Tobacco etch virus protease sequence recognition site and a Flag-Tag (Genewiz) using AgeI and HindIII (New England Biolabs). Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized from 500 ng of total RNA with retrotranscriptase from Moloney murine leukemia virus (Ref. M0253, New England BioLabs) and random hexanucleotides as primers by following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.