Labshake search
Citations for New England Biolabs :
1 - 50 of 327 citations for Acyl CoA Dehydrogenase Very Long Chain ACADVL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... CoA 647 (NEB) was used instead of the CoA ATTO 647N FluoroCube ...
-
bioRxiv - Biophysics 2020Quote: ... and CoA 547 (NEB) was used instead of the CoA Cy3N FluoroCube.
-
bioRxiv - Biophysics 2021Quote: CoA-biotin (New England Biolabs) was coupled to the ybbR-tag of the VWF-dimer constructs in a bulk reaction in the presence of 5 μM sfp phosphopantetheinyl transferase53 and 10 mM MgCl2 at 37 °C for 60 min ...
-
bioRxiv - Biophysics 2020Quote: CoA-biotin (New England Biolabs) was coupled to the ybbR-tag at the C-terminus of the fusion protein constructs in a 90 min bulk reaction in the presence of 4 µM sfp phosphopantetheinyl transferase63 and 100 mM MgCl2 at room temperature (≈ 22°C) ...
-
bioRxiv - Bioengineering 2020Quote: ... using fluorescent CoA 647 (NEB) as substrate ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... The modification of mmACP and mtDod-mmACP (both variants with H8-Tag and without) with CoA 488 (CoA modified with ATTO-TEC dye ATTO 488, NEB #S9348) by Sfp was conducted in phosphate borate buffer (pH 7.4 ...
-
bioRxiv - Cell Biology 2020Quote: ... PLCγ1 nSH2-cSH2-SH3 and truncations were labeled with CoA 647 (NEB, S9350) via an N-terminal ybbR tag ...
-
bioRxiv - Bioengineering 2021Quote: Long Amp Taq Polymerase (New England Biolabs) was used to PCR amplify Plasmid DNA after sort 4 according to manufacturer’s protocol with the following primers:
-
bioRxiv - Microbiology 2020Quote: ... 1x Long Amp Taq Reaction Buffer (NEB), 0.4 mM dNTPs ...
-
bioRxiv - Microbiology 2019Quote: ... then mixed with 10-fold molar excess CoA-Alexa 547 (S9349S, New England Biolabs) and 5 µM ACPS at 37 °C for 90 min ...
-
bioRxiv - Immunology 2022Quote: The paired antibody VH/VL chains were cloned into Igγ and Igk expression vectors using T4 ligase (NEB). Antibodies produced from cell culture supernatants were purified immediately by affinity chromatography using recombinant Protein G-Agarose (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: VH and VL sequences of candidate sequences were cloned into a pcDNA.3 based vector with dual CMV promotor harboring IgG1 heavy chain and light chain backbone using NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... and the V regions were inserted into cut backbone vectors (heavy chain: FJ475055; kappa chain: FJ75056) via Gibson reaction (New England Biolabs). Successful clones were prepared ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 U Long Amp Hot Start Taq DNA Polymerase (NEB) and 156 ng DNA template ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Immunology 2021Quote: The cDNA sequences of the paired variable heavy and light chain region of anti-RBD antibody clones were synthesized as gBlocks (IDT) and cloned by the Gibson assembly (NEB) into human IgG1 heavy chain and light chain expression plasmids ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Microbiology 2022Quote: ... the template chain was digested using DpnI restriction endonuclease (NEB, USA). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB, Ipswich, MA). pSMART-HC-Kan (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Amplicons for long-read sequencing were generated with Q5 High-Fidelity polymerase (M0492S, NEB) using primers #51-52 (Supplementary table 2 ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were undertaken in 25 ul consisting of 1 x Long amp Taq buffer (NEB), 300 μM dNTP mix ...
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: m7G-capped RNA substrates 90 to 1400 nucleotides long were generated by T7 RNA polymerase (NEB) transcription of different DNA templates generated from an FLuc plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... Long (HMSpAa) and short (HMSpBb) splinkerette adaptors were first resuspended with 5X NEBuffer 2 (NEB, B7002) to reach a concentration of 50uM ...
-
bioRxiv - Biophysics 2022Quote: 10 kilobase long λ-DNA was prepared from full-length phage λ-DNA (New England BioLabs) by performing polymerase chain reaction (PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5ng of cDNA were amplified with the long LongAmp Taq 2X Master Mix (New England Biolabs) for 25 cycles ...
-
bioRxiv - Pathology 2021Quote: ... These clones were further analyzed by genomic PCR using Long Amp Taq DNA polymerase (New England Biolabs) to check the downstream inserted sequence ...
-
bioRxiv - Genetics 2022Quote: ... The 37nt long 5’ adaptor was ligated to the small RNAs using T4 RNA ligase (M0204S, NEB) overnight at 16°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Gene-specific LA-qPCR assays for measuring DNA strand-breaks (SBs) were performed as described earlier (7,17,18,22) using Long Amp Taq DNA Polymerase (New England BioLabs). 10 ng of genomic DNA was used as a template to amplify transcribed genes (10.4 kb region of the hypoxanthine-guanine phosphoribosyltransferase [HPRT] ...
-
bioRxiv - Cell Biology 2023Quote: ... SHORT and LONG reporters were generated by assembly (NEBuilder® HiFi DNA Assembly Cloning Kit, E5520S, NEB) of AURKA 5’UTR ...
-
bioRxiv - Biochemistry 2023Quote: ... in a black-bottomed 96-well plate and gene-specific LA qPCR assays were performed as described earlier18,19,41,42 using Long Amp Taq DNA Polymerase (New England BioLabs). Three transcribed (HPRT ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...