Labshake search
Citations for New England Biolabs :
1 - 50 of 618 citations for ATPase H+ Transporting V0 Subunit A1 ATP6V0A1 Antibody HRP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... a MBP antibody (Anti-MBP Monoclonal Antibody, HRP conjugated, NEB), a GST antibody (GST Tag Monoclonal Antibody ...
-
bioRxiv - Biochemistry 2024Quote: ... the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit HRP, BioLabs 7074P2) in 3% BSA in PBS-T shaking for 1-2 h at room temperature ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected using the anti-MBP-HRP antibody (NEB). The bound protein (~42kDa ...
-
bioRxiv - Neuroscience 2020Quote: ... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
bioRxiv - Cell Biology 2020Quote: Endoglycosidase H (endo H; BioLabs), peptide-N-glycosidase F (PNGase F ...
-
bioRxiv - Cancer Biology 2021Quote: ... The membrane was incubated with HRP-conjugated secondary antibodies (1:5000, NEB) for 45 mins at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... HRP-conjugated antibody binding was detected using TMB substrate (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated with anti-mouse HRP antibody (1:5000, NEB 7076S) for 1h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Endoglycosidase H (Endo H, NEB P0702S) (500 U ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was probed with horseradish peroxidase (HRP)-conjugated anti-MBP antibody (NEB) and HRP-conjugated anti-FLAG antibody to detect MBP-TcpB and FBXO22 ...
-
bioRxiv - Immunology 2021Quote: ... endonuclease H (Endo H, New England Biolabs) was added to the samples after reduction and denaturation ...
-
bioRxiv - Cancer Biology 2021Quote: ... & H (NEB) for 30 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... membranes were hybridized with primary and HRP coupled secondary antibodies (New England Biolabs, Ipswich, MA). Membranes were revealed by chemiluminescence with SuperSignal West Dura or Femto reagents and data acquired using the G-BOX-iChemi Chemiluminescence Image Capture system (Syngene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ribosomes with a spytag labeled L17 subunit was used during in vitro translation system (NEB, E3313S) to generate the stalled RNC ...
-
bioRxiv - Biochemistry 2022Quote: ... thermophilus RNase H (Thermostable RNase H, New England Biolabs) at a final concentration of 5 U/μL at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Endoglycosidase H (endo H) (New England Biolabs, catalog #: P0703L) enzyme digestion or Peptide-N-Glycosidase F (PNGase F ...
-
bioRxiv - Microbiology 2020Quote: ... Endo H controls: Cells were treated with Endo H (NEB, 1:10 in glycobuffer 3 ...
-
bioRxiv - Microbiology 2024Quote: ... Single-construct plasmids expressing A-subunits were constructed via restriction digestion (NdeI and PstI, New England Biolabs) and ligation using pBAD24 (Amp+ ...
-
bioRxiv - Microbiology 2020Quote: ... RNase H (NEB), in a total volume of 80µL ...
-
bioRxiv - Cell Biology 2022Quote: ... RNase H (NEB) and dUTP Solution (Thermo Fisher) ...
-
bioRxiv - Genetics 2021Quote: ... RNase H (NEB) and a dUTP solution (Thermo Fisher) ...
-
bioRxiv - Biophysics 2023Quote: ... RNAse H (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... RNAse H (NEB)) ...
-
bioRxiv - Microbiology 2023Quote: ... RNAse H (NEB) was added to remove RNA and samples were incubated at 37°C for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... cell lysates were treated with endoglycosidase H (Endo H) (New England BioLabs) for 1 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were subjected to RNase H (15U/well) or RNase H (NEB) buffer only treatment for 4 hr and RNase III or RNase III buffer (Ambion ...
-
bioRxiv - Genomics 2019Quote: ... or 5μL NEB RNase H reaction mix (10U NEB RNase H [NEB M0297S] and 1uL 10X NEB RNase H reaction buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli Ribonuclease H (NEB) or ddH2O in 1xRibonuclease H buffer (2 h ...
-
bioRxiv - Molecular Biology 2020Quote: The Endo-H (NEB) and PNGase-F (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... coli RNase H (NEB) for two hours at 37 °C before spotting ...
-
bioRxiv - Genetics 2022Quote: ... Rnase H (NEB, M0297) and DNA polymerase I (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Targeted RNase H (NEB) digestions were performed according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... After RNase H (NEB) treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... Endo H (NEB, P0703L); Pierce ECLplus reagent (Thermofisher ...
-
bioRxiv - Cell Biology 2023Quote: ... and endoglycosidase H (NEB) digestion were performed as previously described (65 ...
-
bioRxiv - Neuroscience 2021Quote: ... mutations were respectively inserted in the LEV-1 and UNC-29 subunits by PCR using the Q5 site-directed mutagenesis kit according to the manufacturer’s recommendations (New England Biolabs). The forward and reverse primers used were 5’- GTTCTTTGAGGCAACAGTTGG −3’ 5’- CCGTACAACAAAAACCGATCCA −3’ for G461E substitution in lev-1 cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... To perform in vitro phosphorylation 5 μg of purified GST-NL2CT (WT or S714D) fusion protein was incubated with 2.5kUnits purified catalytic subunit of PKA (NEB) supplemented with 200 μM ATP at 30°C for the indicated time points.
-
bioRxiv - Biochemistry 2021Quote: ... cDNAs encoding each of the CBAF subunits were PCR-amplified using Phusion DNA polymerase in HiFi Phusion buffer (NEB) and subcloned into pLibMam vectors using NEBuilder HiFi (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Trx-linker concatemers (1 mg/mL) were incubated with 50,000 units of the catalytic subunit of cAMP-dependent protein kinase (PKA) (NEB)—which recognizes the RRAS motif within the central linker of the Trx-linker nonamer—in protein kinase buffer (50 mM Tris HCl ...
-
bioRxiv - Neuroscience 2024Quote: ... 4.1 μl of PLPPR3 ICD (final concentration 0.075 mg/ml) was mixed with 0.2 μl purified PKA catalytic subunit (final concentration 20 000 Units; #P6000S, Biolabs), 0.8 μl phosphorylation buffer (final concentration of 25 mM HEPES ...
-
bioRxiv - Genomics 2019Quote: ... or 5μL NEB RNase H reaction mix (10U NEB RNase H [NEB M0297S] and 1uL 10X NEB RNase H reaction buffer) to the RNA-probe mixture and incubated the mixture at 45°C (for Hybridase RNase H ...
-
bioRxiv - Biochemistry 2020Quote: Salivary samples were additionally treated with Endoglycosidase H (Endo H; New England Biolabs), which cleaves the chitobiose core of high-mannose and some hybrid N-linked glycans [21] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50 μL of 1X RNase H Buffer and 5μL of RNase H (NEB) were added to the beads and incubated at 37°C for 30 minutes while nutating ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNase H diluted (1:100) in 1× RNase H buffer (New England Biolabs) was added to the cells and incubated for 2 h at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The heat-denatured samples were incubated at 37 °C for 1 h with 500 units of Endo H (endoglycosidase H; New England Biolabs, Ipswich, MA) in a final volume of 20 µl containing 1 × GlycoBuffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resulting cDNA was PCR amplified using primers A1.MS-SDA-ADDobody-F and tonBtot_R (Table S4) using Q5 DNA polymerase (New England Biolabs) and reactions conditions according to the manufacturer’s recommendations (initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Molecular Biology 2019Quote: ... for the presence of all core TFIIH subunits and appropriate fractions were pulled and mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in washing buffer (400 mM KCl ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... proteolytic subunits were removed from the expression constructs using blunt end deletion following a standard Q5 mutagenesis workflow (New England Biolabs). Additionally ...