Labshake search
Citations for New England Biolabs :
1 - 50 of 3533 citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Molecular Biology 2021Quote: ... 7 units USER Enzyme for 30 minutes at 37°C (NEB)51 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2) 7 µL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per slide was added for deglycosylation and incubated overnight at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Bioengineering 2023Quote: ... The reaction was incubated at 37 °C for 3 hours and stopped by adding 2 Units of DNase I (NEB), to digest the DNA templates and incubating at 37 °C for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.5-1.0 μg of genomic DNA for each sample was heated at 65°C for 2-3 hours prior to digestion with PstI (New England Biolabs, UK). This enzyme has a 6 bp recognition site and leaves a 4 bp overhang ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and elongation for 7 min at 72°C) using the Phusion High-Fidelity DNA Polymerase (NEB, #M0530S) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... Second-strand DNA synthesis was done by ligating 10 µM of a blunt-end duplex comprised of a 32-bp Illumina R1-3’SpC3 and 5’-phosphorylated R1R-3’SpC3 DNA (pre-annealed by incubating at 95°C for 3 min and slowly cooling to 25°C) using a Quick ligase kit (New England Biolabs) according to manufacturer’s protocol followed by clean-up as described above ...
-
bioRxiv - Molecular Biology 2023Quote: Hi-C libraries were treated with 3 U of T4 DNA polymerase (NEB) in the presence of 0.1 mM dGTP (NEB ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Systems Biology 2020Quote: ... One microgram of purified RNA was fragmented at 95 °C for 7 min in 1X T4 RNA Ligase buffer (NEB) with an equal volume of 2X alkaline fragmentation buffer (0.6 volumes of 100 mM Na2CO3 plus 4.4 volumes of 100 mM NaHCO3) ...
-
bioRxiv - Genomics 2022Quote: ... The long RNAs were then fragmented to 70-100 nt by using an NEBNext Magnesium RNA Fragmentation Module (94 °C for 7 min; New England Biolabs). After clean-up by using a Zymo RNA Clean & Concentrator kit (8X ethanol protocol) ...
-
bioRxiv - Cancer Biology 2023Quote: Assessment of the integration status of the HPV-positive HNSCC cell lines was characterized for each cell line and digested with 7 µg of total genomic DNA at 37°C overnight (20 hours) with either EcoRV (New England BioLabs) or Bam HI ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 µg total RNA was incubated at 37°C for 30 min together with DNaseI (2 U, NEB). To inactivate the DNaseI ...
-
bioRxiv - Immunology 2019Quote: ... A 7-mer random peptide library (E8100S, Ph.D. -7, New England Biolabs, USA) was panned overnight at 4°C on pooled human IgM adsorbed on polystyrene plates at a concentration of 0.1 mg/ml ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37 °C for 2 hours followed by digestion with PspXI (NEB) in rCutsmart™ Buffer (NEB ...
-
bioRxiv - Genomics 2019Quote: ... Restriction digest was performed overnight at 37°C with agitation (950 rpm) with HindIII (NEB; 1500 units per 7 million cells). Using biotin-14-dATP (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lenti-sgRNA puro vector was digested with EcoRI for 2h at 37°C followed by digestion with BsmBI for 2 hours at 55°C and treatment with 4 μl of rSAP (NEB) for 1 hour at 37°C ...