Labshake search
Citations for New England Biolabs :
1 - 50 of 5778 citations for 7 Butyl 8 mercapto 1 3 dimethyl 3 7 dihydro purine 2 6 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... rgef-1p and gfp were inserted into a vector containing the sequence rab-7 amplified using PCR and primers 5’-atgtcgggaaccagaaagaa-3’ and 3’-aagcttatcgataccgtcgac-5’ to create rgef-1p::gfp::rab-7::rab-7 3’UTR using Gibson assembly (NEB E2611). A full list of reagents and resources can be found in table S2.
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Biophysics 2021Quote: ... and 3 samples from each replicate combined into 7 mL with 1 × T4 DNA Ligase Buffer (NEB), with 1% Triton X-100 ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2) 7 µL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per slide was added for deglycosylation and incubated overnight at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... A 7-mer random peptide library (E8100S, Ph.D. -7, New England Biolabs, USA) was panned overnight at 4°C on pooled human IgM adsorbed on polystyrene plates at a concentration of 0.1 mg/ml ...
-
bioRxiv - Genetics 2023Quote: ... 1 ul of 5 mM 7-deaza-dGTP (NEB), 1 ul of 25 mM MgCl2 (Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... and once the solution is clear 48 uL of the elution was transferred to a 2mL Lo-Bind tube with End-Repair and A-tail buffer (7 uL) and enzymes (3 uL) premixed (NEBNext® Ultra™ II kit, New England Biolabs). The solution was then mixed by gentle tapping and transferred to a 0.2 mL PCR tube and incubated at 20 degrees C for 30 minutes and 65 degrees C for 30 minutes in a thermocycler ...
-
bioRxiv - Microbiology 2022Quote: ... and exon 7 (BSErI, NEB). PCR amplicons were also purified with MinElute PCR Purification Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Genomics 2023Quote: ... 7 μL Q5 high GC enhancer (NEB), 0.07 μL 100mM dATP ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Molecular Biology 2019Quote: ... Luciferase activity was determined in a luminometer (Optocomp I) by the addition of ∼18 µl of sample to 6-7 µl diluted coelenterazine (for Gluc, NEB), or ∼20 µl of sample to 15-18 µl Fluc substrate (Promega).
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 7 μl Polynucleotide Kinase (10 U/µl; NEB) in a total of 100 μl and incubation for 20 minutes at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 μL Murine RNase Inhibitor (New England Biolabs, M0314) was added ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Bioengineering 2019Quote: ... 7-mer random peptide phage library (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 µL Ultra II End-prep reaction buffer (NEB, E7647A), 3 µL Ultra II End-prep enzyme mix (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell extracts (average OD 7) were treated with MNase (NEB), CaCl2 (5mM final concentration) ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...