Labshake search
Citations for New England Biolabs :
1 - 50 of 6622 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ ends were hydroxy-repaired by adding T4 polynucleotide kinase reaction mix (NEB) which was incubated for 45 minutes at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Biophysics 2019Quote: ... 10 μl of 100 μM DNA oligos containing an amino group modification at their 5’ends were mixed with 8 μl of 20 mM BG-GLA-NHS (NEB) in 40 μl of 50 mM HEPES buffer containing 50% anhydrous DMSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of 10 mM dATP and 3 μl of 5 U/μl of Klenow fragment (3′→ 5′ exo (-)) (NEB, M0212) were added and the sample was incubated for 30 min at 37 °C followed by a deactivation step at 65 °C for 20 min ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: The nascent RNAs bound to Streptavidin Dynabeads were 5’ de-capped by diluting in RNA 5’ Pyrophosphohydrolase (RppH) mix (NEB) and incubation at 37 °C for 45 minutes ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 μl 5 U/μL Klenow Fragment (NEB, M0210S) and 2 μl T4 PNK (NEB ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Biochemistry 2020Quote: ... Klenow 3’ to 5’ exo (NEB: M0212) and Biotin-11-dUTP (40 μM ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Developmental Biology 2019Quote: ... 7.5U Klenow 3’-5’ exo minus (NEB) were incubated for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.5 μl Klenow Fragment (3’->5’ exo-) (NEB, cat#M0212S, 5 U/μl) per amplicon pool reaction ...