Labshake search
Citations for New England Biolabs :
1 - 50 of 4771 citations for 6 methyl 4 oxo 5 6 dihydro 4H thieno 2 3 b thiopyran 2 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Genomics 2019Quote: ... and 6 µL Klenow (5 U/µL, NEB), and DNA blunting was carried out for 1 h at room temperature with shaking at 800 rpm ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Neuroscience 2020Quote: ... comprising 6 mM 5’ cap analog (New England Biolabs), 7.5 mM adenosine triphosphate and 1.5 mM guanosine triphosphate (USB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... ligation was performed during 4h at 22°C in the presence of truncated RNA ligase 2 (NEB)30 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 0.32 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.16 μL Q5 (NEB M0491S) ...
-
bioRxiv - Genomics 2023Quote: ... 0.7 μL 10mM 5-methyl-dCTP (NEB N0356S), 0.35 μL Q5 (NEB M0491S) ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 500 µM each of 5’-methyl-dCTP (NEB N0356S), dATP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Immunology 2021Quote: ... and ROI 2 were amplified from C57BL/6 genomic DNA by PCR using the Q5® High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA). PCR products were ligated into pSCB-Amp/Kan using the StrataClone Blunt PCR Cloning Kit (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL 20mg/ml BSA and 5 μL 400U/μl T4 DNA Ligase (NEB, M0202) overnight at 16°C (tumbling ...
-
bioRxiv - Genomics 2022Quote: ... then A-tailed by incubating for 1 h at 37°C with 200 μM dATP and 0.2 U/μL Klenow fragment (3’-5’ exo-) in NEBuffer 2 (NEB), then Illumina PE adapter was added by incubating overnight at 20°C with 15 μM PE adapter and 2000 U T4 DNA ligase in ligase buffer ...