Labshake search
Citations for New England Biolabs :
1 - 50 of 2216 citations for 6 Fluoroquinoxalin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... The RNA was then diluted 1:50 and 2 mL were used to perform a one-step qPCR protocol using Luna Universal One-step qPCR kit (NEB). Two primer sets were used ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 6 µl NEBuffer 2 (New England Biolabs, B7002S), 2 µl Klenow enzyme (5 units/µl ...
-
bioRxiv - Microbiology 2023Quote: ... or deglycosylated by an 1h treatment with PNGase F (NEB) then eluted in 2X Laemmli as previously described.
-
bioRxiv - Microbiology 2023Quote: ... 6 ng of sample was treated with 2 units T4 Polynucleotide Kinase (NEB) and incubated at 37°C for 30 min ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Mixes were subsequently digested 1h at 37 °C with DpnI (NEB) and used for electroporation in E ...
-
bioRxiv - Microbiology 2019Quote: ... NEB One Taq One-Step RT-PCR Kit (NEB # E5310S) was used for nucleic acid amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was phosphorylated for 1h at 37°C with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Systems Biology 2020Quote: ... The resulting PCR products were digested for 1h at 37°C with DpnI (NEB) and transformed in competent Escherichia coli MC1061 cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Backbones were linearized with PCR or with restriction enzymes (NEB, 1h at 37°C). PCR-amplified or digested products were purified (Monarch PCR & DNA Cleanup Kit ...
-
bioRxiv - Plant Biology 2023Quote: ... Digested DNA was dephosphorylated for 1h by 10U of antartic phosphatase (New England Biolabs). DNA adaptator was ligated overnight with 2,000 u of T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... USA). DNA amplification from a single colony (i.e. colony PCR) was performed with One Taq 2× Master Mix (NEB). Electrocompetent P ...
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of each 100 μM oligo was added to 500 μl 1x NEB buffer 2 (New England Biolabs, www.neb.com). The p201N:Cas9 plasmid was linearized by digestion with Spe1 (www.neb.com ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Genomics 2021Quote: ... One μL APOBEC3A (NEB #E7120S) was added directly to the reaction with 10 μL of 10x APOBEC3A reaction buffer and 1 μL BSA (10 mg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution (NEB) DNase digestions were performed ...
-
bioRxiv - Neuroscience 2021Quote: ... Genes of interest were amplified with the One Taq One-Step RT-PCR kit (NEB) using 1 μg of RNA ...
-
bioRxiv - Microbiology 2021Quote: ... with Luna Universal One-Step Rt-qPCR & Probe One-Step RT-qPCR Kits (NEB, USA), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNAs were diluted 1:10 and 2 μl of each used for subsequent PCR reactions with one unit of Taq polymerase (New England Biolabs, MA), 200uM dNTPs (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... One-step qRT-PCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) and 5 ng RNA per reaction in technical duplicate with a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... One was to use a kit to generate sequencing libraries in one-tube reactions (NEB, E7103S). Another modification was to spike-in the panel of synthetic nucleosomes carrying major histone methylations (EpiCypher ...
-
bioRxiv - Genomics 2023Quote: ... one female and one male HRFI) were artificially methylated using the M.Sss1 Enzyme (New England BioLabs) following the manufacturer instruction ...
-
bioRxiv - Genetics 2020Quote: ... A 6 µL mixture containing 2 µL of 40 µM Spy Cas9 NLS protein (New England Biolabs, MA, USA), 200 ng each of five sgRNAs (in 2 µL ...
-
bioRxiv - Microbiology 2021Quote: ... One microliter of RNase H (NEB) was added to each tube ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution DNase (NEB) digestions were performed ...
-
bioRxiv - Molecular Biology 2022Quote: ... Beads were washed 2 times with EB2 without NaF or PhosStop and one time with λpp buffer (New England Biolabs, Ipswich, MA) before resuspension in 40 μl of λpp buffer ...
-
bioRxiv - Genomics 2023Quote: ... an exonuclease treatment was carried out at 37°C for 1h with 10U of exonuclease I (NEB) in 1X exonuclease buffer (NEB) ...
-
bioRxiv - Neuroscience 2022Quote: ... One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England BioLabs) in a total volume of 20 µl and a template concentration of 50 ng/µl according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... NEB One Taq RT-PCR kit (One Taq® RT-PCR Kit, New England Biolabs INC, Frankfurt, Germany) was used for cDNA synthesis ...
-
bioRxiv - Neuroscience 2024Quote: One-step RT-qPCR was performed using the Luna universal One-Step RT-qPCR kit (New England Biolabs) in a total volume of 10 µl and a template concentration of 50 ng/µl according to manufacturer’s recommendation ...
-
bioRxiv - Genomics 2021Quote: ... One microliter of QuickCIP (New England Biolabs) was added and the solution was incubated at 37 °C for 10 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... One microliter of T7 endonuclease Ⅰ (NEB) was added to the sample ...
-
bioRxiv - Bioengineering 2022Quote: ... and one with BseYI (NEB cat# R0635S) according to manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Genomics 2022Quote: ... and the presence or absence of one of two RNAse inhibitors (1 – Millipore Sigma, Protector RNAse Inhibitor, Cat. No. 3335399001; 2 – NEB, RNAse Inhibitor, M0314S). The RNA was then extracted from the tissue using the miRNeasy kit (Qiagen Cat ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the parts were assembled with Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix from NEB, 1h at 50°C) with the linkers providing sequence overlaps ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were washed in CutSmart buffer, and incubated (1h, RT) in 150 µL blunting mix (112.5 µL ddH2O, 15 µL 10x blunting buffer, NEB, 15 µL 100 µM dNTPs ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated nucleotides from the non-ligated DNA ends were removed by incubating the Hi-C libraries (2 μg) in the presence of 6 U of T4 DNA polymerase (NEB; Cat#: M0203L) in NEBuffer 2.1 supplied with 0.025 mM dATP (Thermo Fisher ...
-
bioRxiv - Plant Biology 2023Quote: ... The up- and downstream flanks were obtained by PCR on gDNA of IPO323 with primer pairs 1&2 and 5&6 (Table S7) respectively using Q5 Hot Start High fidelity DNA polymerase (NEB, Evry, France). The hph was amplified from pCAMBIA0380 with the primers 3 and 4 (Table S7) ...
-
bioRxiv - Microbiology 2021Quote: ... purple (6×) (New England Biolabs). Samples were loaded into a 4-15% precast polyacrylamide gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... Random Primer 6 (NEB, #S1230S), RNasin Ribonuclease inhibitor (Promega ...
-
bioRxiv - Genomics 2024Quote: ... and random primer 6 (NEB). The NEBNext Ultra II Non Directional RNA Second Strand Synthesis Module was subsequently used to convert single-stranded cDNA to double-stranded cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNAs were used as templates for SYBR green-based one-step reverse-transcriptase quantitative PCR (RT-qPCR) using the NEB Luna One-Step RT-qPCR kit (New England Biolabs). All primers were validated by standard curve analysis and had PCR efficiencies ranging from 90-110% ...