Labshake search
Citations for New England Biolabs :
1 - 50 of 4422 citations for 6 Fluoro 1 3 benzodioxene 8 carbonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... α1- 3,4,6), 10 U β-galactosidase (P0726S, β1-3) and 8 U β-galactosidase (P0746S, β1-3,4) (all from New England BioLabs, USA). All reactions were performed in a final volume of 10 μl in 50 mM sodium acetate buffer ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mM calcium chloride and 200 unit/ml final concentrations of micrococcal nuclease (NEB). Cell lysates were incubated at 25 ℃ for 15 minutes before adding 3 mM final concentration of EGTA was added.
-
bioRxiv - Developmental Biology 2021Quote: ... 6-8 µg of Cas9-mSA plasmid was linearized by Not1-HF restriction enzyme (NEB #R3189S). The 8.8kb linearized fragment was cut out from a 1.5% agarose gel and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen #28115) ...
-
bioRxiv - Biochemistry 2020Quote: ... The substrate was designed such that the digested strand is 6 nt shorter than the undigested strand to allow 3′ fill-in by Klenow Fragment (3′-5′ exo-; NEB) with α[32P]-dCTP and cold dATP ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.2 µl 10 mM zinc chloride (New England Biolabs) was included ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 8 units of T4 RNA ligase 1 (NEB) and 8 nmol of ATP in a final volume of 8 μl for 1 h at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 8 μL of solution A and 6 μL of solution B were mixed with 16 U RNase Inhibitor (NEB), gBlock templates (2 nM each ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μg of the purified DNA was digested with 8 units of Endo V (New England Biolabs) in a 200 μL reaction at 37 °C for 2 h ...
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 8 µl RNase III (1:1000 diluted, New England Biolabs) or RNase If (1:100 diluted ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.0) containing 8 units mL−1 proteinase K (NEB, P8107S) at 37 °C for 4 h ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of plasmid was incubated with 8 U M.SssI (NEB) at 37°C for 4 h for in vitro DNA methylation ...
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2024Quote: ... protein aliquots were subjected to PNGase F or a broad range mannosidase (α1,2/3/6) (New England Biolabs, France) digestion according to the manufacturer’s specifications ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL 1:1,249 diluted Fe2+ solution (NEB)) at 37°C for 1 h ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Bioengineering 2019Quote: ... with 3, 6, or 12 nM iSpinach DNA (IDT, USA, Ultramers) template in transcription buffer (1x RNAPol Reaction Buffer (NEB, No ...
-
bioRxiv - Immunology 2023Quote: ... 1μl Cas9 (diluted 1:3 in diluent B, NEB), 1μl water (water was replaced with 100ng/μl trib1 RNA for cop1 experiments) ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Genomics 2020Quote: ... 1 μl (3 U/μl) of T4 DNA polymerase (NEB), 1 μl (10 U/μl ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 mM rNTPs (NEB #N0466S), 250 U T7 RNA Polymerase (NEB #M0251L ...
-
bioRxiv - Biophysics 2023Quote: ... 8 μl XhoI (NEB, R0146S) and 8 μl DpnI (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Genomics 2023Quote: ... beads were incubated with 10 µL of USER mix (1 µL of 10X USER buffer and 1 µL of USER enzyme in 8 µL of nuclease-free water, NEB) and incubated at 37°C for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ribodepleted RNA were then ligated to 10 pmol of a biotinylated 3’ adapter, (3’-Adap TAIL-seq, Supplementary Table 7) using 10 units of T4 RNA ligase 1 (NEB) in a final volume of 10 μl for one h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in mec4p::Lamp-1::GFP.
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 µl klenow polymerase (NEB M0210L) and 37.5 µl Biotin-14-dATP (Thermo 19524016 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 8 ul 5X HF buffer (NEB), 1 ul 25 uM library 1st round forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl 50% PEG 8000 (NEB), 1.3 μl T4 RNA ligase (30 U/µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 units of RNAse inhibitor (NEB), and 10 µm of malachite-green dye was added to each reaction.
-
bioRxiv - Neuroscience 2023Quote: ... 8 U/mL Proteinase K (NEB)) and incubated overnight at RT ...