Labshake search
Citations for New England Biolabs :
1 - 50 of 3299 citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Immunology 2021Quote: ... Step 3 was cloned into Step 4 with T4 DNA ligase (NEB) and then this recominbeering fragment (5’ arm of homology ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... 4 mM MgSO4 (NEB; final, 6 mM Mg2+), 1 mM each dNTP (Enzynomics) ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg of plasmid was treated with 1U Klenow Fragment (3’ to 5’ exo-, NEB) for 10 min at 37°C to fill any remaining gapped plasmid 12 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Microbiology 2023Quote: ... 4% DMSO (Biolabs), 200 nM of each primer kdpAB(37) ...
-
bioRxiv - Biochemistry 2023Quote: ... buffer 4 (NEB, identical composition to rCutsmart buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 10x buffer 4 (New England Biolabs, NEB), 2 μL of 1 mg/ml bovine serum albumin solution (NEB) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4: 4°C hold) using NEB Next High-Fidelity master mix (NEB) in 25 µl reaction volume using RAD-Marker for/ RAD-Marker rev primers (25 nM each ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 µL linearized expression plasmid was assembled with 3 µL each of PCR amplified product using 4 µL of NEBuilder HiFi DNA Assembly MasterMix (#E2621L, New England Biolabs) in a 96-well plate format ...
-
bioRxiv - Bioengineering 2022Quote: ... the two primers which contain the gRNA and have 4 nt overhang at 5’-end were annealed (3) the annealing product was ligated with PaqC I (New England Biolabs)-digested pMM002P or pMM005 ...
-
bioRxiv - Molecular Biology 2021Quote: ... was digested with PmeI and SacII restriction enzymes for 3 to 4 hours at 37°C and dephosphorylated using Antarctic Phosphatase (NEB) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Backbone was amplified with primer pair 3/4 and fragments were assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... Oct-4 (NEB, D7O5Z), Sox2 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ml ScaI (BioLabs), followed by 3 h of incubation with a fresh portion ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4 μl T4 RNA ligase 2 (NEB, catalog no. M0239) for 16 hours at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2 ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... at 95°C for 5 min and incubated with 80000 units of O-glycosidase and 100 units of neuraminidases for 4 hours at 37°C following the NEB kit protocol (E0540S; NEB). Samples were resolved on 15% Tris-tricine SDS-PAGE gel and blotted using anti-Cterm OCN goat antibody.
-
bioRxiv - Genomics 2019Quote: ... and 4 U MmeI (NEB) for 2 h at 37 °C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1×Buffer 4 (NEB). The reaction was stopped (6 mM EGTA ...
-
bioRxiv - Genomics 2022Quote: ... 6.25x NEBuffer 4 (NEB, B7004S)) was added to each well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 4 mM SAM (NEB). RNAs were then purified with the RNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Genomics 2023Quote: ... 1.5 μL NEBuffer 4 (NEB), 0.75 μL T4 Phage β-glucosyltransferase (NEB M0357S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-4-points were induced in the miR-29a seed binding site using the Q5 Site Directed Mutagenesis Kit (NEB, Cat#E0554S). 20 ng of recombinant dual-luciferase plasmid and 6 pmol of either miR-29a mimic or scrambled control were mixed with 100 μL Opti-MEM containing 1 μL lipofectamine RNAiMax (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2′O-methylated using Vaccinia 2′O Methyltransferase (New England Biolabs). The IRES-containing mRNAs were uncapped and polyadenylated.
-
bioRxiv - Neuroscience 2021Quote: ... with 3’-O-Me-m7GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at 8:1 to GTP for a capping efficiency of ∼90% ...
-
bioRxiv - Developmental Biology 2021Quote: ... custom NTP mix was prepared with 3’-O-Me-m7G cap analogue (60mM, NEB), GTP (75mM ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2’O-methylated using Vaccinia VP39 (2’O Methyltransferase) (New England Biolabs), then purified by phenol-chloroform extraction and ethanol precipitation.
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 U of SssI (NEB) or 4 µl purified Eco72IM (diluted 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... in 1X NEBbuffer 4 (NEB #B7004), or an equivalent volume of ultra-pure water and 1X NEBbuffer 4 ...