Labshake search
Citations for New England Biolabs :
1 - 50 of 5412 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... coli BL-21 (DE3) (New England Biolabs) cells and 5mL starter cultures were grown overnight at 37C in Lysogeny Broth (LB ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL-21 cells (New England Biolabs) were used for the transformation of pET-28b(+ ...
-
bioRxiv - Microbiology 2021Quote: ... streptavidin magnetic beads (21 μL per reaction; NEB) were washed once in an equal volume of 1X SSC and then resuspended in 7.5 μL per reaction 1X SSC with 1 μL per reaction of Superase-In (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli C2527 (BL-21) (New England Biolabs, Inc) for purification ...
-
bioRxiv - Cell Biology 2020Quote: ... a 21 kb genomic DNA fragment of bacteriophage lambda (NEB) was flanked by a unique XbaI (position 0 ...
-
bioRxiv - Cell Biology 2020Quote: ... The gene fusion was then amplified using primers 20 and 21 and cloned into pClimDC linearized at the SalI restriction site using Gibson Assembly (New England Biolabs). To build pClimDC-Lifeact:mCh ...
-
bioRxiv - Cell Biology 2022Quote: ... pET17b-Kif5b(1-560)-GFP-His was transformed into BL-21[DE3]RIPL cells (New England Biolabs) until an optical density at 600 nm of 0.6-0.8 and expression was induced with 0.5 mM isopropyl-β-d-thiogalactoside (IPTG ...
-
bioRxiv - Microbiology 2023Quote: NINL (1-702) containing an amino-terminal HaloTag was expressed in BL-21[DE3] cells (New England Biolabs), which were then grown until OD 0.4-0.6 and induced with 0.1 mM IPTG for 16 hr at 16°C ...
-
bioRxiv - Biophysics 2021Quote: MukF Flag-tagged fragments were expressed from pET 21 plasmids in C3013I cells (NEB).The Flag-tagged MukE and MuF were at the C-terminus ...
-
bioRxiv - Biochemistry 2019Quote: Activating adaptors containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at OD 0.4-0.6 with 0.1 mM IPTG for 16 hr at 18°C ...
-
bioRxiv - Cell Biology 2021Quote: Activating adaptors containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at OD 0.4-0.6 with 0.1 mM IPTG for 16 hr at 18°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate,100 μg/mL BSA, pH 7.9, NEB), 20 U RiboLock ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1× CutSmart buffer (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, 100 µg/ml BSA or recombinant albumin; NEB), 0.5 mM 1,4-Dithiothreitol (DTT) ...
-
bioRxiv - Biophysics 2023Quote: ... The reaction was mix using 1× CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 μg/mL BSA; NEB) and 0.5 mM DTT (1,4-dithiothreitol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and chromatin was digested for 7.5 minutes at 21°C using micrococcal nuclease (MNase) (New England Biolabs). We spiked DNA from D ...
-
bioRxiv - Biochemistry 2023Quote: BicD2 and NINL containing amino-terminal HaloTags were expressed in BL-21[DE3] cells (New England Biolabs) at an optical density at 600 nm of 0.4–0.6 with 0.1mM IPTG for 16h at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... L1 - Adaptor.L8 with Adaptor.S (21)) was annealed with the DNA fragments by T4 DNA ligase (New England Biolabs) incubating overnight at 16 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... A-tailed fragments were ligated to 50 nL of 5 mM T7 promoter containing adapters(21) with cell barcodes and UMI with 150 nL ligation mix (25 nL T4 DNA ligase (400.000U, NEB), 3.5 nL MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... which was subsequently cloned into linearized pUHE-21 (106) using NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs). Construct was verified by Sanger DNA sequencing with primers 146 and 156.
-
bioRxiv - Synthetic Biology 2023Quote: ... The lipid film was rehydrated by vortexing with 21 μL rehydration solution (14 μL PURExpress Solution A, 0.875 μL RNase Inhibitor (NEB), 17 μM IGEPAL (90mM) ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid hcm1 sequence was amplified by PCR for 21 cycles with vector specific primers using Phusion High-Fidelity DNA polymerase (New England Biolabs). Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: A second-generation lentiviral transfer plasmid encoding expression of EF1ɑ promoter - CAR-P2A-mCherry (21) was digested with XbaI & MluI (New England Biolabs) to drop out the CAR-P2A-mCherry transgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and 21-base pair (bp) barcodes (post-culture) were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Primers used are listed in Supplemental Table 11 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments containing 21 base pair overhangs homologous to the vector backbone were generated by PCR using Phusion High-Fidelity DNA polymerase (NEB, M0530), purified ...
-
bioRxiv - Neuroscience 2020Quote: ... with PAM underlined: GCAACTGGTACAGATGACACAGG) targeting exon 21 of the Brp gene was generated using the HiScribe T7 Kit (New England Biolabs #E2040S) by incubating for 6 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... or 300 ng (day 21) of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs E7490L). Libraries were prepared using the NEBNext Ultra II RNA Library Prep kit with Sample Purification Beads (E7775S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of total RNA were ligated to the pre-annealed custom RT adaptors (21) using concentrated T4 DNA Ligase (NEB-M0202T). Ligated RNA was reverse transcribed using Maxima H Minus RT (Thermo Scientific ...
-
bioRxiv - Bioengineering 2024Quote: cDNA of each library was generated using oAS345 (Supplemtary Note 21) and LunaScript Primer-Free RT Master Mix Kit (NEB E3025S).
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Biochemistry 2023Quote: ... or 20 U of enterokinase (16 U/µL) (P8070, New England Biolabs) in SEC buffer ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was mixed with Reaction Mix 1 (9:1 of 12 uM NEB RT random 6N-S to 12 uM oligo-dT(20), 12uM dNTPs ...
-
bioRxiv - Microbiology 2021Quote: ... primers that contained restriction sites for BamHI and XmaI or XbaI (Table S5, primers No. 9-16 and 95-98) and the high-fidelity polymerase Q5 (New England Biolabs) according to vendor’s manual ...
-
bioRxiv - Genomics 2023Quote: ... 3 µL 10x NEBuffer 4 (NEB), 3 µL of 1 mM each dATP/ddCTP/ddGTP/ddTTP (dATP/ddBTP ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... The variant library was ligated into each vector with a 1:3 (insert: vector) T4 ligation at 16°C overnight (NEB). Ligations were DNA cleaned (Zymo) ...
-
bioRxiv - Biophysics 2023Quote: ... we dilute the stock DNA to a final concentration of 6 mg/mL with 1/10th volume of 10× CutSmart Buffer (0.5 M Potassium Acetate, 0.2 M Tris-acetate, 0.1 M Magnesium Acetate; New England BioLabs), 0.1% Tween (to prevent non-specific interactions) ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Microbiology 2022Quote: ... 15 μl 20% SDS and 3 μl 20 mg/ml Proteinase K (NEB #P8107) was added to the sample and the mixture was incubated at 37 °C for 30 min with agitation at 1400 rpm to completely lyze the cells ...
-
bioRxiv - Genomics 2022Quote: ... 16 µl RNA were mixed with 4 µl LunaScript master mix (NEB cat# E3010L), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Microbiology 2022Quote: ... Either 3-5 µL of Color Prestained Protein Standard-Broad Range (11-245 kDa) (New England Biolabs, P7712) or 1-3 µL of PageRuler Prestained Protein Ladder (10-180 kDa ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Genomics 2021Quote: ... followed by an overnight incubation at 16°C with 3 µL T4 DNA ligase (NEB, M0202). Samples were purified with phenol-chloroform and used as 3C templates for Taqman-qPCR ...
-
bioRxiv - Genetics 2023Quote: ... We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles, Tm 62 °C). We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (9 μg) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described in Smola et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... gently resuspended in fixation buffer (PBS, 0.1% saponin, 4% PFA, RNAsin [New England Biolabs #M0314] 1:20) and incubated for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µM gRNA pool (3 gRNAs in total) in 4× Cas9 Reaction Buffer (New England Biolabs) at 25°C for 10 min in a 5 µl reaction volume ...