Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for 5 Hydroxytryptophan 5 HTP CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and sequenced on a NextSeq 2000 instrument (Srp2-HTP & Dbp2-HTP) or with the NEBNext Fast DNA Library Prep Set for Ion Torrent Kit (NEB) and sequenced on an Ion Torrent Proton (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Biophysics 2024Quote: ... and Monarch PCR&DNA Cleanup Kit (5 μg) (NEB). The purified dsDNA templates were transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... and m7G(5′)ppp(5′)A (NEB, #S1405S) also referred throughout the manuscript as N7-meGpppG and N7-meGpppA for consistency ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL RNase H (5 U/µL, NEB), 2.5 µL RNase III (1 U/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Biochemistry 2019Quote: 5’-Phosphorylated linker (Oligonucleotide K, Supplementary Table 6) was adenylated using a 5’ DNA Adenylation Kit (New England Biolabs) at 20x scale and purified by TRIzol extraction as previously described56 ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl Taq 5× Master Mix (New England Biolabs) and 18 µl Milli-Q water (18.2 MΩ cm) ...
-
bioRxiv - Developmental Biology 2023Quote: ... then capped with m7G(5’)ppp(5’)G (NEB) and tailed with a poly(A ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit) followed by a 1 h incubation at 25°C ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NNN spacer to increase library diversity during sequencing (preadenylated oligos were prepared by 5’ DNA adenylation kit (E2610L) using thermostable 5’ App DNA/RNA ligase (M0319L, both from New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM HDVLig (pre-adenylated using a 5’ adenylation kit (NEB)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...