Labshake search
Citations for New England Biolabs :
1 - 50 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and detected using components based on the Phototope-Star detection kit (New England BioLabs, Cat# N7020). All T ...
-
bioRxiv - Immunology 2022Quote: ... 5µl of RNA (roughly corresponding to 1µg) was reverse transcribed to cDNA using the LunaScript RT SuperMix kit - dye based qPCR detection (NEB) following manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... 5µl of RNA (roughly corresponding to 1µg) was reverse transcribed to cDNA using the LunaScript RT SuperMix kit - dye based qPCR detection (NEB) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mutants selected for cloning were also analysed via T7 endonuclease I-based (T7E1) heteroduplex assay according to the manufacturers protocol (EnGen® Mutation Detection Kit, NEB #E3321), and the length of digested and undigested fragments were visually compared by gel electrophoresis (Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... Mammalian cell lines were handled under sterile conditions using a laminar flow hood and the cells were regularly tested for mycoplasma contamination with a PCR-based mycoplasma detection kit (Minerva-Biolabs, cat.no. 11-1250). Subcultivation was performed every 2-4 days at a confluence of maximum 80 % using trypsin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... The S358A mutation was introduced into the STING ORF in this construct using Q5 site-directed mutagenesis kit (NEB). Virus generation from these constructs and cell transduction were as described (Sidorova et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... gR1 AIP5-3309 and gR2 AIP5-3309 primers were designed based on this tool and hybridized at a concentration of 3 µM in 1×T4 DNA ligase buffer (NEB) by initial heating and subsequent cooling steps ...
-
bioRxiv - Cancer Biology 2021Quote: ... a PCR-based Q5 site-directed mutagenesis kit (NEB) was used according to the manufacturer’s instructions ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... The LPHN-1 and -3 genes were amplified by PCR and digested by T7 endonuclease using the EnGen Mutation Detection Kit (New England Biolabs) according to directions in combination with the custom primers that flank the appropriate CRISPR-targeting regions (Fig ...
-
bioRxiv - Physiology 2022Quote: ... EnGen Mutation Detection Kit (New England BioLabs) was used for amplification of target DNA ...
-
bioRxiv - Developmental Biology 2024Quote: The PCR-based Q5 Site-Directed Mutagenesis Kit (NEB, #E0554S) was used to perform truncation (constructs L-P ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-terminal truncation of murine STING (to include only amino acids 1-339) was accomplished using NEB Q5 High-Fidelity 2X Master Mix (NEB M0492S) per the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The LAMP reaction in the 2-step LAMP-CRISPR detection was performed using the WarmStart® LAMP Kit (NEB #E1700), using primer concentration described in literature (“Rapid Detection of SARS-CoV-2 Using Reverse transcription RT-LAMP method,” 2020) ...
-
bioRxiv - Cell Biology 2022Quote: ... or homologous recombination based NEBuilder® HiFi DNA Assembly kit (NEB, MA). Site-directed mutagenesis was carried out using QuikChange QuikChange Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Microbiology 2021Quote: ... 12.5 μl was purified using a silica column-based kit (New England Biolabs, cat#T1030S ...
-
bioRxiv - Synthetic Biology 2019Quote: ... purified (column-based NEB Monarch®PCR & DNA Cleanup Kit ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Systems Biology 2019Quote: ... the Nickel-NTA beads were incubated in 80 μl 3’-linker ligation mix with (1 X PNK buffer, 1 µM 3’-adapter, 10% PEG8000, 30U Truncated T4 RNA ligase 2 K227Q (NEB, M0351L), 60U RNasin) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... Editing efficiency was assessed using the EnGen Mutation Detection Kit (NEB) (E3321S ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Synthetic Biology 2019Quote: ... purified (column-based NEB Monarch®PCR & DNA Cleanup Kit; New England Biolabs, Ipswich, USA) and the DNA quantity/quality was measured by photometry (Spectrophotometer UV5Nano ...
-
bioRxiv - Genomics 2024Quote: ... a SYBR green I based qRT-PCR kit (Luna Universal One-Step NEB, Ipswich, USA) was used in PCR mixtures (20 µl ...
-
bioRxiv - Microbiology 2019Quote: ... using Agilent High Sensitivity DNA kit in a Bioanalyzer 2100 instrument then quantitated using qPCR based NEBNext Library Quant Kit for Illumina (New England Biolabs) with a Piko-Real Real-Time PCR System (Thermo Fisher Scientific ...
-
All-trans retinoic acid induces synaptopodin-dependent metaplasticity in mouse dentate granule cellsbioRxiv - Neuroscience 2021Quote: ... and RNA was consecutively isolated using a column based RNA isolation kit according to the manufacturer’s instructions (Monarch® Total RNA Miniprep Kit; #T2010S New England Biolabs). Strand specific cDNA library preparation from polyA enriched RNA (150 bp mean read length ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified by silica-based SPE using Monarch RNA Cleanup Kits (for in vitro assays) or Total RNA Miniprep Kit for intracellular samples (NEB).
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg BSA and 3 units of T4 DNA polymerase (NEB) and incubated at 20 °C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μl of Klenow Fragment (3’→5’ exo-) (M0212L, NEB). The reactions were incubated at 37ºC for 30 minutes and then cleaned up with a Clean and Concentrate-25 column (Zymo) ...
-
bioRxiv - Microbiology 2021Quote: ... SYBR green based RT-qPCRs were performed using Luna Universal One-Step RT-qPCR Kit (NEB).
-
bioRxiv - Neuroscience 2020Quote: ... University of Cambridge) using the NEBuilder® HiFi DNA Assembly kit based on manufacturer’s instructions (NEB). Transgenic animals were validated by RT-PCR for correct insert ...
-
bioRxiv - Microbiology 2023Quote: ... based on the manufacturer’s recommendations (NEB). Strains were inoculated at a concentration of 5 x 105 CFU/mL in MHII broth containing colistin (0.5 – 128 μg/mL ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pmex-5::PH-GFP-cyk-1(700-1437)::tbb-2 3’UTR in the pCFJ150 backbone [89] was made using HiFi cloning (New England Biolabs). Notably ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q, New England Biolabs) at 22 °C for 3 h ...
-
bioRxiv - Microbiology 2019Quote: ... The probe was detected by chemiluminescence using the Phototope-Star Detection Kit (NEB) and autoradiographic film ...
-
bioRxiv - Molecular Biology 2023Quote: ... Editing activity of α-synCas was evaluated using EnGen Mutation Detection Kit (NEB). Briefly ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...