Labshake search
Citations for New England Biolabs :
3651 - 3700 of 10000+ citations for Human Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Molecular Biology 2023Quote: Libraries for ChIP-seq were prepared with NEBNext Ultra II DNA Library kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Biophysics 2023Quote: ... The NEBuilder HiFi DNA Assembly and Q5 site-directed mutagenesis kits (New England Biolabs) were used for plasmid construction ...
-
bioRxiv - Biophysics 2023Quote: RNA synthesis was performed according to the HiScribe SP6 RNA Synthesis Kit protocol (NEB). Double-stranded DNA sequences containing SP6 promoter 5′ATTTAGGTGTGACACTATAG 3′ were used as DNA matrixes for RNA transcription.
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2023Quote: ... we utilized the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA), following the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: ... and processed with the NEBNext Ultra II DNA library preparation kit (New England Biolabs). Sequencing was performed on MiSeq sequencers (Illumia) ...
-
bioRxiv - Molecular Biology 2023Quote: DNA from positive clones was extracted using a Monarch Genomic DNA Purification kit (NEB). DNA insertion was confirmed by amplification of a fragment including both genomic and kanamycin resistance cassette sequences followed by the sequencing of amplified DNA (Macrogen).
-
bioRxiv - Cell Biology 2024Quote: ... after ribosomal RNA (rRNA) depletion using an NEBNext rRNA Depletion Kit (New England Biolabs). Paired-end (2 × 36 bases ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted using NEB Monarch Total RNA miniprep kit (NEB cat. T2010S) following manufacturer’s manual with on-column DNase I digestion ...
-
bioRxiv - Genomics 2024Quote: ... rRNA was depleted using the NEBNext® rRNA Depletion Kit (Bacteria) (NEB, MA, US) from 500 ng of total RNA ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmids were assembled using the NEBuilder HiFi DNA Assembly kit (New England BioLabs). The different truncated or point mutants derived from these plasmids were generated by PCR amplification using primers (Supplementary Table 6 ...
-
bioRxiv - Biophysics 2024Quote: ... the mixture was purified using the Monarch PCR and plasmid DNA purification kit (NEB), eluted in 10 mM Tris-HCl pH 8.0 and stored at -20 °C for further experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were prepared by NEBNext Ultra II DNA Library Preparation Kit protocol (NEB #E7645L) and analyzed by Agilent 4200 TapeStation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library was prepared using Ultra II Directional RNA Library Prep Kit (NEB, Cat #E7765) for all samples ...
-
bioRxiv - Biophysics 2024Quote: ... WGBS libraries were prepared using the NEBNext Ultra DNA Library Prep Kit (NEB #E7370L) according to manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2024Quote: ... University of Oxford using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, #E7760) and sequenced on NovaSeq6000_150PE (150 bp paired-end directional reads ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were cleaned using a 50 μg Monarch RNA Cleanup Kit (New England Biolabs) and treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... Amplicons were purified from PCR buffer using Monarch PCR cleanup kit (New England Biolabs) and submitted for Sanger sequencing (EtonBio).
-
bioRxiv - Bioengineering 2024Quote: ... cDNA synthesis was carried out with the LunaScript RT SuperMix Kit (New England Biolabs), using a thermocycler program consisting of a primer annealing stage at 25°C for 2 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted with the NEB Monarch RNA miniprep kit (NEB cat. T2010S) following manufacturer’s manual with on-column DNA digestion ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina Nova-seq S4 instruments ...
-
bioRxiv - Cell Biology 2024Quote: ... for neuron infection using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). iPSC-derived neurons were infected using viral particles diluted in N2B27 media (5 MOI ...
-
bioRxiv - Biochemistry 2024Quote: ... digestion and the RNA transcripts were purified by the RNA Transcript Purification Kit (NEB) and dissolved in RNase-free double-distilled H2O.
-
bioRxiv - Synthetic Biology 2024Quote: ... Mutation of ORF2 RT domain was introduced using Q5 site-directed mutagenesis kit (NEB). Deletion of ORF2 EN domain was performed by PCR and ligation cloning.
-
bioRxiv - Microbiology 2024Quote: ... coli and catP of pMTL83151 were ligated using Gibson Assembly kit (New England Biolabs) (Fig ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was synthesized using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) and qPCR performed using iTaq Universal Probes Kit (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... The cDNA was synthesized using the LunaScript™ RT SuperMix Kit (New England Biolabs) in 20 μL reaction containing 4 μL SuperMix (5X ...
-
bioRxiv - Genetics 2024Quote: ... we generated RNA-seq libraries using the NEBNext Rrna Depletion Kit (New England Biolabs) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... The library kit and type of sequencer were TruSeq Stranded Total RNA (NEB Microbe) and NovaSeq ...
-
bioRxiv - Immunology 2024Quote: ... and NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared with the NEBNext Ultra II DNA Library Prep Kit (NEB #E7645) and sequenced on an Illumina NextSeq 500 using 75-nucleotide read length paired-end sequencing.
-
bioRxiv - Molecular Biology 2024Quote: RNA of translated using the PURExpress ΔRibosome Kit (New England Biolabs Cat No. E3313S). The translation reactions contained 0.4 μM mRNA ...
-
bioRxiv - Microbiology 2024Quote: ... ligation-based library preparation was performed using a NEBNext Ultra II DNA Kit (NEB). The library was then subjected to Illumina NovaSeq paired-end sequencing (150-bp).
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were purified using the Monarch PCR and DNA Cleanup Kit (NEB, #T1030L) prior to Sanger sequencing ...
-
bioRxiv - Genomics 2024Quote: ... The assembly was then purified with the Monarch PCR & DNA cleanup kit (NEB, T1030S), eluted in 6 µL of water ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II Directional kit(NEB, Cat no E7760L) with ribodepletion (Qiagen QIAseq FastSelect -rRNA HMR Kit ...
-
bioRxiv - Molecular Biology 2024Quote: ... the NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs, E7645L) was used as described previously (56 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The library kit and type of sequencer were TruSeq Stranded Total RNA (NEB Microbe) and NovaSeq ...
-
bioRxiv - Genomics 2024Quote: ... The NEBNext® Ultra II Directional RNA Library Prep kit (New England Biolabs, USA) was used for RNA sequencing library construction ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing libraries were prepared using the NEBNext Ultra-II RNA kit (New England Biolabs) according to a previously described protocol27 ...
-
bioRxiv - Genomics 2024Quote: ... and dual-barcoded using a New England Biolabs Ultra II Directional kit (NEB #E7765). Individually labelled samples were pooled and sequenced using a paired end protocol and a read length of 150bp ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons were purified using the Monarch DNA and PCR Cleanup Kit (New England Biolabs) and precipitated as per the Co-Precipitant Pink (Bioline ...
-
bioRxiv - Genomics 2024Quote: ... we prepared genomic libraries with the NEBNext Ultra FS II kit (New England Biolabs) and resequenced the whole genomes at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was then purified using Monarch Total RNA miniprep Kit (New England Biolabs, T2010S) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and clean-up performed using Monarch® RNA Cleanup Kit (Biolabs, New England, T2030L).
-
bioRxiv - Genetics 2024Quote: ... PCR amplifications were performed using Phusion High-Fidelity PCR kit (New England Biolabs #M0530L) according to manufacturer’s protocol using 50 ng template DNA per 100µL reaction and 18 cycles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Recovery products were then purified with the Monarch® PCR & DNA Cleanup Kit (NEB) and eluted in 10 µl of the Monarch® DNA Elution Buffer ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was used as a template for PCR (Phusion HF kit (New England Biolabs)) with primers designed to amplify the spike and HE genes (Table 2) ...
-
bioRxiv - Immunology 2024Quote: ... transcribed in vitro using HiScribe™ T7 High Yield RNA Synthesis Kit (#E2040S, NEB) and purified with RNA Clean & Concentrator™ (#R1017 ...