Labshake search
Citations for New England Biolabs :
3451 - 3500 of 10000+ citations for Human Dachshund Homolog 1 DACH1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... We cloned each fragment into pMiniT using the PCR Cloning Kit (New England BioLabs), following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Total RNA was then isolated using Monarch Total RNA Miniprep Kit (New England Biolabs). cDNA was synthesised from 350 ng of total RNA from each sample using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... mRNA libraries were prepared with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) and size selection for libraries was performed using AMPure XP system (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The transcripts were purified using the Monarch® RNA Cleanup Kit (50 μg) (NEB) and verified on a 6% PAA ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR products were column-purified (Monarch PCR & DNA Clean-up Kit, New England BioLabs) and submitted for Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: ... rRNA was removed from the total RNA using a NEBNext rRNA depletion kit (NEB), and RNA was converted to a DNA library using a TruSeq stranded total RNA kit (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... point mutations were introduced using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... The pME_EB3-mScarlet-I was cloned using the Gibson Assembly cloning kit (NEB #E2611S) according to the manufacturer instruction ...
-
bioRxiv - Systems Biology 2024Quote: ... the enzyme’s activity was immediately neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). Subsequently ...
-
bioRxiv - Synthetic Biology 2023Quote: ... after which DNA was extracted using Monarch genomic DNA purification kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and transcribed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Cat. # E2040S), template concentration 10 nM ...
-
bioRxiv - Cell Biology 2024Quote: ... coli cells using the Q5 mutagenesis kit in accordance with the manufacturer’s instructions (NEB). For FACS rescue experiments with WT-CHC22 or 11TD-CHC22 ...
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were spin-purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) or the DNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2024Quote: ... RNA samples were purified using the Monarch® RNA Cleanup Kit (New England Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... the library was prepared using the NEBNext DNA Library Prep Kit (New England BioLabs). The constructed library was sequenced on Novaseq 6000 platform (illumina ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext® Ultra™ ll Directional RNA Library Prep Kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2024Quote: ... 5 min ice) and plasmids were extracted using the Monarch Plasmid Miniprep kit (NEB) following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from collected spermatids fractions with Monarch RNA extraction kit (NEB) according to manufacturers’ protocol for RNA extraction from tissue or leukocytes ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Libraries were pooled and sequenced with paired end sequencing on a Novoseq 6000 (Novogene).
-
bioRxiv - Developmental Biology 2024Quote: The mRNA isolation utilized the NEBNext Poly(A) mRNA Magnetic Isolation Kit (NEB, #E7490) with 1 μg of total RNA ...
-
bioRxiv - Zoology 2024Quote: ... and pMi{Hau-cif7-ngfp}) were produced using NEBuilder HiFi DNA Assembly kit (NEB). The pMi base plasmid was linearized by double digestion with SpeI and SacII ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gRNAs were synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using the Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Minipreps were performed using Monarch Plasmid Miniprep kit (New England Biolabs, Ipswich, Massachusetts, USA) and PCR products were purified with Monarch PCR and DNA Cleanup kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs). qPCR was performed on a LightCycler 480 real time PCR system (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit (NEB) and sequenced on the HiSeq 2500 Sequencing System (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... rRNA depletion was achieved using the NEBNext rRNA depletion kit v2 (NEB, Cat# E7400L), and subsequent end-repair ...
-
bioRxiv - Molecular Biology 2024Quote: ... End prep and adaptor ligation was performed using the Enzymatic Methyl-seq kit (NEB). Conversion was performed identically to the amplicons ...
-
bioRxiv - Microbiology 2024Quote: ... The purified products were quantified using the NEBNext Library Quant kit for Illumina (NEB) and sequenced using a mid-output reagent cartridge with 2×150 paired-end reads on an Illumina Miniseq platform ...
-
bioRxiv - Microbiology 2024Quote: ... cells were lysed and RNA purified using the Monarch Total RNA Miniprep Kit (NEB) according to the manufacturer’s instructions except that the on-column DNase treatment was omitted ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library prep kit (New England Biolabs) following manufacturer’s instructions for H3K9ac CUT&RUN DNA ...
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid was blunted by digestion with Quick Blunting™ Kit (NEB, USA) and ligated to re-circularize the plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2024Quote: RNA was extracted using the Monarch Total RNA miniprep kit (New England Biotechnologies (NEB) #T2010 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the library for sequencing was constructed with FS DNA Library Prep Kit (NEB, E7805) by following the manual instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA (>300 ng) was reverse transcribed using the Lunascript RT Supermix Kit (NEB, E3010).
-
bioRxiv - Developmental Biology 2024Quote: ... and then immediately followed by Library prep using NEBNext Ultra II kit (NEB, E7770). Libraries were pooled and sequenced using a H75 kit from Illumina in a NextSeq500 sequencer following manufacturer’s instructions.
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting RNA was purified using the Monarch RNA cleanup kit (New England Biolabs) and analyzed by agarose gel electrophoresis.
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using NEBNext® kit for Illumina® (New England Biolabs, E7630S), pooled at equimolar amounts ...
-
bioRxiv - Cell Biology 2023Quote: ... All amplified fragments were then combined using Gibson assembly (Gibson assembly cloning kit, NEB) with 20 base pair overhangs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted first using a Monarch® Total RNA Miniprep Kit (NEB T2010) with on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: Deletion of vpr was achieved using Q5 Site-Directed Mutagenesis kit (New England Biolabs) where the majority of the vpr coding sequence was deleted using PCR exclusion (forward - CAGAATTGGGTGTCGACATAG ...
-
bioRxiv - Synthetic Biology 2024Quote: ... while Gibson assembly reactions used the NEBuilder(R) HiFi DNA Assembly Cloning Kit (NEB). Transformed bacteria were grown for 24h at 32°C ...
-
bioRxiv - Zoology 2023Quote: ... or the Genome Institute of Singapore (GIS) using NEBNext DNA Library Preparation Kits (NEB). Paired-end sequencing was performed on Illumina Miseq (2x300-bp or 2x250-bp ...
-
bioRxiv - Immunology 2024Quote: ... Gibson assembly was performed using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). 100 ng/μl of pET770 was co-injected along with a body wall muscle co-injection marker (17 ng/μl ...
-
bioRxiv - Genetics 2024Quote: ... cDNA synthesis was performed using the ProtoScript® First Strand cDNA Synthesis Kit (NEB). One microliter of oligo d(T)23VN primer (50 μM ...