Labshake search
Citations for New England Biolabs :
301 - 350 of 1267 citations for Yellow Fever virus Envelope protein sheep Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Microbiology 2022Quote: ... which was assembled with oligo DNA containing Myc or FLAG tag sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The resultant plasmids were named pcDNA3-C-Myc or pcDNA3-C-FLAG ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Biochemistry 2024Quote: ... C-terminal mEGFP-tag and HSP18 terminator for assembly into pICSL86955 using BsaI (ThermoScientific) restriction enzyme and T4 DNA ligase (New England Biolabs). The GoldenGate restriction-ligation-reaction was transformed into E ...
-
bioRxiv - Microbiology 2022Quote: ... we amplified the gene ctl0382 (homolog of ct127) with a six histidine tag in the reverse primer using Phusion enzyme (NEB), and the PCR product was linked with pBOMBL::L2 linearized by EagI and KpnI using HiFi assembly system (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The yrbA-fs15 DNA templates (with TAG or TGA stop codons) used for in vitro transcription/translation reactions in the classic PURExpress system (New England Biolabs) were prepared by PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... pCIG2-SNAP-M87 (generated for this study from pCIG2-GFP-MACF43 by replacing GFP with SNAP-tag from pSNAPf vector (New England Biolabs) and MACF43 with M87 from pCMV-Tag/WT M87) ...
-
bioRxiv - Biochemistry 2023Quote: ... following the manufacturer’s protocol and adapting the IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) System (NEB # 6901S). The human eIF2A coding sequence was cloned into the C-terminal Mxe GyrA Intein-chitin-binding domains (CBD ...
-
bioRxiv - Plant Biology 2023Quote: AtXRCC4 fused to a hexa-histidine followed by a GST tag (pGAT3-atxrcc4) was expressed in BL21(DE3) cells (NEB), The proteins were purified using GST sepharose (Cytiva) ...
-
bioRxiv - Microbiology 2023Quote: ... encoding a C-terminal myc tag were cloned into NcoI and HindIII sites of pHERD20T-myc and pHERD30T-myc using Gibson Assembly (NEB) or Hifi Assembly (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... A TEV protease cut site preceding the 6x histidine tag was previously introduced using the Q5 Site-Directed Mutagenesis Kit from NEB and the GeneJET Plasmid Miniprep Kit from ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Specific forward primer targeting E1 and a reverse primer targeting the nongenomic tag were used in 20 ul SYBR Green reaction with 1x Luna qPCR Dye (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... with an N-terminal human CD33 signaling peptide and C-terminal 12xHis purification tag was codon optimized and ordered as a gBlocks Gene Fragment (IDT) with overhangs for Gibson assembly (NEB). The sequence was engineered to have a single Cys in the EC5 domain for site-specific labeling as previously described11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was amplified from afp18-3CTS with primers including a stop codon before the tag and closing the linear fragment using the KLD enzyme mix from New England Biolabs (NEB). Positive clones were confirmed with colony PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant BimC plasmid was generated by integration of the BimC cDNA fragment into a modified Novagen pET-17b vector containing a 6xHis-tag and a GFP using Gibson Assembly (NEB). Plasmid region corresponds to the 71-1184 amino acids of BimC and the modified vector was amplified and assembled with KLD Enzyme Mix Reaction (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... Tag variants were generated by ligating synthetic dsDNA oligos (IDT) encoding each respective tag downstream of GFP bewteen BamHI and HindIII sites (NEB). In order to generate the GFP-VapCYALAA fusion ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Lambda Protein Phosphatase (NEB) assay was performed as described by the supplier ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 protein (NEB M0641S) and phenol red injection dye ...
-
bioRxiv - Developmental Biology 2021Quote: Cas9 protein (M0646, NEB) and sgRNAs against antisense of exons 14 ...
-
bioRxiv - Plant Biology 2024Quote: ... The correct sequence was introduced into the destination vectors pCAMBIA1300-2× 35S [enhanced cauliflower mosaic virus (CaMV) 35S promoter] at the restriction enzyme sites BamHI and PstI (New England BioLabs, Ipswich, MA, USA). The sgRNAs were designed through CRISPR-P 2.0 (http://crispr.hzau.edu.cn/cgi-bin/CRISPR2/SCORE ...
-
bioRxiv - Plant Biology 2021Quote: Purified LPR1 protein was analyzed using Protein Deglycosylation Mix II (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein (200 µg) was precleared with protein G magnetic beads (New England Biolabs) and incubated overnight (4° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved G protein was dephosphorylated by lambda protein phosphatase (NEB, Frankfurt, Germany), calf intestinal phosphatase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The protein ladder used was Colour Protein Standard Broad Range (NEB, Ipswich, US).
-
bioRxiv - Plant Biology 2024Quote: ... 2µg of recombinant protein was mixed with 400U lambda protein phosphatase (NEB, #P0753S) at 30°C for 30 min before separated by an SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Biochemistry 2022Quote: ... The library was cloned into a pENTR1A plasmid backbone with a C-terminal YFP HA reporter tag using Gibson Assembly (HiFi DNA Assembly Cloning Kit, New England Biolabs, (NEB), Ipswich ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by PCR and subcloned into pMRX-IP backbone vector together with the EGFP tag by Gibson Assembly (New England Biolabs, E2611L). All deletion and point mutation mutants of LC3B and GABARAP were generated by a PCR-based method.
-
bioRxiv - Molecular Biology 2022Quote: ... and BGH reverse (5’-TAG AAG GCA CAG TCG AGG -3’) primers from the pcDNA3.1+/-C-(K)-D vector using standard methods (NEB 2x Q5) which include 5-10 ng DNA per reaction ...
-
bioRxiv - Neuroscience 2019Quote: ... A V5 tag was inserted before the stop codon by Q5 site-directed mutagenesis kit (New England Biolabs, Ipswich, MA, USA). Afterwards ...
-
bioRxiv - Bioengineering 2020Quote: ... and cloned into pET vector in frame with a C-terminal 6XHis tag by Gibson assembly (NEBuilder® HiFi DNA Assembly Master Mix, New England Biolabs). DNA encoding SARS-CoV-2 S RBD (S a.a ...
-
bioRxiv - Cell Biology 2022Quote: ... the sequence encoding amino acids 1-490 was amplified with NdeI and EcoRI overhangs and inserted into a modified backbone based on pSNAP-tag(T7)2 (NEB #N9181S) before a SNAPf-EGFP-6His tag (Budaitis et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Neuroscience 2023Quote: ... Integration of the amplified mouse genomic DNA into the donor plasmid and integration of the 3x HA tag before the stop codon were each carried out by Gibson assembly (NEB, USA). HDR into C57BL/6J background mouse embryos was carried out by mixing the plasmid donor ...
-
bioRxiv - Biophysics 2023Quote: ... PUS1D134A lacking the N-terminal HIS-tag was subcloned into expression vector pET21d (EMD Biosciences) using a Gibson Assembly cloning kit and protocol (NEB # E5510S) and sequence verified ...
-
bioRxiv - Developmental Biology 2023Quote: ... This plasmid was modified to include a C-terminal V5 tag using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). For arnt1-myc ...
-
bioRxiv - Immunology 2021Quote: ... IDEZ was used to cleave the Fab (in the supernatant) from the Fc (remained on the magnetic beads) (New England Biolabs) for 1 h at 37°C and collected ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... purified proteins were directly digested by O-glycosidase (P0733, NEB, 4,000 units/µg protein) and α2-3 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were also treated with Lambda Protein Phosphatase (Lambda PP, New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... an RNA-protein complex was formed with 1 µM Cas9 protein (New England Biolabs) and 1 µM gRNA pool (3 gRNAs in total ...