Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Rat Epithelial Discoidin Domain Containing Receptor 1 DDR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... containing 12.4 U/uL RNase If (New England Biolabs) and 0.025 U/uL DNase I (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 6,25µl of LongAmp Taq 2✕ Master Mix (NEB), 4,25µl of milliQ water ...
-
bioRxiv - Biochemistry 2023Quote: ... in 15μl reaction volumes containing the Cutsmart buffer (NEB) or a reconstituted equivalent (50mM Potassium acetate ...
-
bioRxiv - Cancer Biology 2023Quote: ... Effective sgRNA containing constructs were selected by T7E1 (NEB) cleavage assay following manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1.5 μl of NEBuffer r2.1 (New England Biolabs). Finally ...
-
bioRxiv - Genomics 2023Quote: ... containing 9U of T4 DNA polymerase (NEB, Cat#M0203S) and 40μM dATG/dGTP and incubated at 20℃ for 4 hours to remove unligated fragments ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 0.4 U/ml RNAse inhibitor (New England Biolabs) and were immediately transported to the sequencing facility on ice for further processing.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was PCR amplified (primers hFUR Exon 1-3 PCR For and hFUR Exon 1-3 PCR Rev) and purified (Monarch PCR & DNA cleanup kit, NEB). The resulting PCR product was sequenced using the hFur Exon 1 Seq primer.
-
bioRxiv - Microbiology 2021Quote: ... 500 μl of lysed cells were transferred to a tube containing 4.5 ml of digestion mix (1X NEB 3 buffer, 1% triton X-100) and 100 μl of the lysed cells were transferred to a tube containing 0.9 ml of digestion mix ...
-
bioRxiv - Neuroscience 2021Quote: Libraries were prepared from 1 ug RNA using a library prep kit (NEB #7770), rRNA depletion kit (NEB #E6310) ...
-
bioRxiv - Genetics 2024Quote: ... immunoprecipitated RNA and 1% input RNA Monarch RNA Cleanup Kit (New England Biolabs, T2047L) was used according to the manufacturers’ instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg RNA was reverse transcribed to cDNA using LunaScript RT SuperMix Kit (NEB). qPCR was performed in 20 μl reactions containing diluted cDNA ...
-
bioRxiv - Neuroscience 2024Quote: ... RT-qPCR was performed using the LUNA 1-step RT-qPCR kit (E3005L, NEB) on an AriaMx Real-time PCR system (G8830A ...
-
bioRxiv - Biophysics 2020Quote: ... containing 0.2 mM ATP (New England Biolabs Inc., Ipswitch, MA) as well as 1.0 mM DTT (Carl Roth ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... SDS 0.5%) containing 0.5 μL Proteinase K (20mg/ml, NEB) at 50°C for 2hr ...
-
bioRxiv - Developmental Biology 2020Quote: ... a mix containing 2 μl of RNAse H (NEB, #M0297S), 1 μl of E ...
-
bioRxiv - Molecular Biology 2020Quote: ... The dUTP containing strand was degraded with USER enzyme (NEB) and beads were re suspended after washing in 20μl 10mM Tris-HCl pH8 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.5 μg RNA probe containing T7 RNA polymerase (NEB) transcribed NFIB 3’ UTR HP RNA or AR RNA / NFIB 3’ UTR RNA hybrid RNA as control ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 100 μg/mL RNase A (New England Biolabs, USA) for 15 min at 37°C and away from light ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5% NP-40) containing 2 μl RNase Inhibitor (M0314, NEB) and 10 μl m6A antibody (ab151230 ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: Twenty microliter reactions containing 10U Exonuclease VIII truncated (NEB, USA) were set up according to the manufacturer’s instructions and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... pSNAPf vector containing SNAP-tag was purchased from NEB (N9183S) and optimised to Drosophila codon suing Genewiz (USA ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was extracted from 1 ml of overnight culture with the kit Monarch HMW DNA Extraction kit (T#3060 New England Biolabs; Ipswich, MA, USA) following the manufacturer instructions for High Molecular Weight DNA extraction from gram-negative bacteria ...
-
bioRxiv - Microbiology 2021Quote: ... the purified cDNA was PCR amplified and barcoded using ONT’s PCR Barcoding Expansion 1-12 (EXP-PBC001) or PCR Barcoding Expansion 1-96 (EXP-PBC096) kits with LongAmp Taq 2x Mastermix (NEB, Ipswich, MA).
-
bioRxiv - Genomics 2019Quote: ... expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1) expressing ATG7 isoform 1 was derived from pCMV-myc-Atg7(2) using the Q5 site-directed mutagenesis kit (NEB, Ipswich, MA). Subsequently ...
-
bioRxiv - Developmental Biology 2022Quote: ... (2019): 1) the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760) was used for library preparation ...
-
bioRxiv - Genomics 2019Quote: ... mRNAs were isolated from 1 μg of total RNA using a PolyA selection kit (NEB) and sequencing libraries were prepared using the NEBnext Ultra RNA library prep kit for Illumina (NEB) ...
-
bioRxiv - Genetics 2019Quote: ... mRNAs were isolated from 1 μg of total RNA using a PolyA selection kit (NEB) and sequencing libraries were prepared following instructions from NEBs Ultra Library Preparation Kit for Illumina ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 μg total RNA was depleted of rRNA using the NEBNext rRNA Depletion kit (NEB). To capture nascent RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and the amplicons were extracted from a 1% agarose gel (Monarch Gel Extraction Kit, NEB). Inserts were then cloned into a pCDH1 lentiviral vector ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was generated from 1 µg RNA using LunaScript RT SuperMix Kit (New England Biolabs). qPCR reactions were performed on an Applied Biosystems 7500 Real-Time PCR system using the Luna Universal qPCR MasterMix (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... The polyA containing RNA was then fragmented with fragmentation buffer (NEB)and first strand cDNA was synthesized using random hexamers and M-MuLV Reverse Transcriptase (RNase H-) ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37°C and cDNAs were amplified with KAPA HiFi Hotstart Ready Mix (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Genetics 2019Quote: ... each containing 25 µl 2x LongAmp Taq Master Mix (M0287, NEB), 3 µl cDNA PRM primer (cPRM ...
-
bioRxiv - Microbiology 2021Quote: ... in 20μL of reaction mixture containing 1x NEB3 buffer (NEB, USA) and 1u/μL RNasin RNase Inhibitor (Promega ...
-
bioRxiv - Immunology 2021Quote: ... a mix containing 2 μl of RNAse H (NEB, Cat. #M0297S), 1 μl of E ...
-
bioRxiv - Biochemistry 2021Quote: A reaction master mix containing 1X T4 DNA Ligase Buffer (NEB) (2.5 μl/sample volume of 10X T4 DNA Ligase Buffer) ...
-
bioRxiv - Neuroscience 2021Quote: ... Digestion solution containing proteinase K (8U/mL, New England BioLabs, P8107S) was applied to gels and allowed to digest for 2-16 hours (see Results ...
-
bioRxiv - Neuroscience 2020Quote: ... and sorted directly into lysis buffer containing RNAse inhibitor (NEB E6420). cDNA libraries were made from RNA using NEB’s Next Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB E6420) ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 1 hour at 37℃ and were finally washed once with 0.1x SSC buffer.
-
bioRxiv - Plant Biology 2021Quote: ... cDNA-containing chips were then subjected to Exonuclease I (NEB, M0293L) treatment for 3 hours at 37 °C and were finally washed once with 0.1x SSC buffer ...
-
bioRxiv - Genetics 2021Quote: ... We injected worms with an injection mix containing Cas9 EnGen (NEB), 4 sgRNAs against mir-1 (AAGAAGTATGTAGAACGGGG ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 150ul of 10X NEB T4 DNA ligase buffer (NEB, B0202), 125ul of 10% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 40 μl reaction mix containing 5 μl Isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Immunology 2020Quote: ... 0.09% Tween-20) containing 0.2 mg/ml protease K (NEB, P8107S) and incubating at 56°C for 1 hour ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20µL of digestion mix containing 125U HinfI (New England BioLabs, #R0155M) and 25U RsaI (New England BioLabs ...
-
bioRxiv - Neuroscience 2021Quote: Samples containing Nluc-GPC4 were treated with Heparinase II (NEB P0735S) and Heparinase III (NEB P0737S ...