Labshake search
Citations for New England Biolabs :
3101 - 3150 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Table 4 was end labeled using gamma-ATP and T4 Polynucleotide Kinase radioactive labeling protocol from NEB. Labelled oligos were purified using GE Healthcare illustra ProbeQuant G-50 Micro Columns and the membrane was probed overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions were cooled to 4°C for 30 seconds and quenched with 1.2 mM unlabeled SAM (NEB) and blotted onto Hybond-XL membrane ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoprecipitation was performed overnight under rotation at 4 using 1/100 T7RNA antibody (Biolabs CB MAB-0296MC) and antiflag (Sigma F1804 and F3165) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pull-down was performed with 100 μl pre-blocked (NETS buffer with 4 mg/ml BSA (NEB) and 2 mg/ml tRNA (SigmaAldrich) ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were pelleted at 4℃ and washed once with cold 1.4 × NEB buffer 3.1 (NEB Cat#B7203S). Nuclei were then re-suspended in 25μl of 1.4 × NEB buffer 3.1 and treated with 0.1% SDS for 10min at 65℃ ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 4 h at 16°C using 10,000 units of T4 DNA ligase (NEB) in 1.2 mL of ligation buffer (120 μL of 10× T4 DNA ligase buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 10 µl of each sample was mixed with 4 µL native loading dye (1% Orange G (NEB) dissolved in 50% glycerol and 50% EMSA buffer ...
-
bioRxiv - Plant Biology 2019Quote: ... For alkaline phosphatase treatment, microsomal pellets were obtained as described previously (Inada et al., 2004) and resuspended in the 1× NEBuffer 3 (NEB) with 0.5% Triton-X100 and protease inhibitor mixture (Complete Mini EDTA-free ...
-
bioRxiv - Biochemistry 2020Quote: ... to 3 μM concentration in a total volume of 50 μl and mixed with 20 μl amylose beads (New England BioLabs). After mixing the proteins and the beads ...
-
bioRxiv - Microbiology 2021Quote: The chimeric CrPV-aNCV infectious clone was derived from the full-length CrPV infectious clone (pCrPV-3; Accession KP974707) (35) using Gibson assembly (New England BioLabs), per the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... were cloned into a dual U6 (1+3 promoter) expression construct pCFD4 provided by the Mann lab using Gibson assembly (New England Biolabs). The donor construct and the guide RNA construct were injected into wlig4 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 fragments have been inserted into pCS2+ plasmid linearized with Xho1 using the Gibson Assembly Cloning Kit (New England Biolabs): a first fragment of 4161bp of the ancBE4max to the PIM domain (amplified using the primers F-5’-CGATTCGAATTCAAGGCCTCATGAAACGGACAGCCGAC-3’ and R-5’-CGGTCTGGATCTCGGTCTTTTTCACGATATTC-3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sgRNA products synthesized by VSW-3 RNAP and T7 RNAP were purified with Monarch RNA Cleanup kit (New England Biolabs) and then further purified by high performance liquid chromatography (HPLC ...
-
bioRxiv - Cell Biology 2022Quote: ... an enzyme mixture of 3 μl in volume that contains 0.01 U Bst 2.0 DNA polymerase (New England Biolabs, United States), 0.5 U SplintR ligase diluted with Diluent A (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA (3 μg) was applied for poly(A) mRNA purification by using oligo-d(T) magnetic beads (S1419S, NEB). RNA fragmentation ...
-
bioRxiv - Genomics 2019Quote: ... 3’ P ends of RNA were dephosphorylated by resuspending bead-nuclei in 190 µL dephosphorylation solution (1× PNK buffer (NEB), 0.1% Triton X-100 ...
-
bioRxiv - Biochemistry 2020Quote: ... Filters were then washed with 3 aliquots of 100 μL 50 mM ABC pH 8.0 before adding 1000U PNGase F (NEB #P0704) in 2M urea ...
-
bioRxiv - Microbiology 2020Quote: ... 5’ – GGA GAA AAC CTT TAC TTC CAG GG-3’ and 5’ – AAT GGA TCC CAG GGG CCC-3’ using the Q5 Site-Directed Mutagenesis protocol according to the manufacturer guidelines (New England Biolabs). Michael Malim (King’s College London ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Universal PCR primer for Illumina (5’-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC-s-T-3’) and NEBNext Index primer for Illumina (NEB, index# 9-13 for five libraries in each repeat) ...
-
bioRxiv - Molecular Biology 2019Quote: ... four point mutations were introduced in the 3′ exon of the tricRNA reporter (see Supplementary Figure S1) using Q5 Site-Directed Mutagenesis (NEB). For primer sequences ...
-
bioRxiv - Microbiology 2019Quote: ... This resulted in a SphI-end of TEF2 ORF-GFP-XhoI-NotI-TEF2 3’ flank-AatII fragment and a SphI-end of TEF2 ORF-mCherry-XhoI-NotI-TEF2 3’ flank-AatII fragment that were digested with SphI and AatII and ligated into pUC19 (NEB) to form pMBL183 and pMBL184 ...
-
bioRxiv - Genetics 2019Quote: ... with a KAPA Hyper Prep Kit (KAPA, kk8502) and then processed by 3 μl of USER™ Enzyme (NEB, M5505L) at 37°C for 15 min to open up the loop ...
-
bioRxiv - Cell Biology 2019Quote: The tcb3 gene including 500bp of the 5’ UTR and 100 bp of the 3’ UTR was amplified from purified genomic DNA using Phusion DNA polymerase (New England Biolabs). 5’Sal1 and 3’Sac1 restriction sites were introduced with amplification primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... and pSP64-eGFP-F-nos1-3’UTR (Weidinger et al., 2002) constructs were linearised with SacII and NotI restriction enzymes (NEB) respectively ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and then mixed the plasmids with gBlocks in a 1:3 molar ratio in the presence of NEBbuilder HiFi DNA (New England Biolabs) assembly mix according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... NEBNext Ultra II End-prep reaction buffer (7 μl) and NEBNext Ultra II End-prep enzyme mix (3 μl, both from New England Biolabs) were added to each sample ...
-
bioRxiv - Genetics 2020Quote: ... 5’-CAA GCA GAA GAC GGC ATA CGA GAT-3’) and 20U/μl Q5 DNA Polymerase in 1X Q5 DNA polymerase reaction buffer (New England Biolabs). Reaction conditions were the same as Pre-Selection PCR ...
-
bioRxiv - Microbiology 2021Quote: The coding sequence of CTSL was tagged with a 3’V5 and cloned into CSIN using NEBuilder HiFi DNA Assembly (NEB) with primers CTSL_3’_V5_F ...
-
bioRxiv - Molecular Biology 2020Quote: ... Subcloned cells were screened for correct targeting by PCR amplification and restriction enzyme digestion (MCM10 exon 3, Hpy199III (NEB R0622); CDC45 exon 3 ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Biochemistry 2020Quote: ... These beads were then resuspended in equal amounts of PBS+ DNaseI digestion buffer with 3 ul (6U) of DNAseI (M0303S, NEB) and incubated at 37°C for 40min - 1h and separated by centrifuging at 2000 rpm for 2 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Either the wild-type or the mutant version of the PRNP 3’U R were inserted into the digested pmirGLO vector by performing a Gibson Assembly following manufacturer`s instructions (NEB). After transformation of the cloned vectors and purification of the DNA using EndoFree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2021Quote: ... The flow cell was washed with water 3 times and then loaded with EcoRI-HF cocktail (1U EcoRI-HF (R3101, NEB) in 1X CutSmart NEB buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... and 3 kb of upstream sequence containing the promoter was amplified from Arabidopsis genomic DNA using Phusion polymerase (New England Biolabs) using flanking primers and then the primers RSH1-F (TCCGTCTTGTCTGAATCAGCT ...
-
bioRxiv - Plant Biology 2021Quote: ... and the 3’ UTR sequence (310 bp downstream of the stop codon) were amplified by PCR using Phusion DNA polymerase (NEB) from genomic Col-0 DNA with IRT1p_-1024F 5’- CACCGACACATTAAACATTCATACCCGATT-3’ and IRT1_1546R 5’- CTTTAATTTACTTATCTTGAAAAAGCAGC-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... The RNA fragments were ligated with 3’-barcoded adaptors at 22 °C for 1 h and 30 min using T4 RNA Ligase (NEB). Barcoded RNA samples were pooled together ...
-
bioRxiv - Microbiology 2020Quote: ... designed to bind upstream of the polyA- tail at the 3’ end of the genome and dNTPs (10 mM, NEB), and incubated at 65 °C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNAs were isolated from Calu-3 infected cells 48h post infection using the Luna Cell Ready Lysis Module (New England Biolabs). Viral RNA were quantified by qRT-PCR in triplicate as described in [27] ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped with the addition of 0.2% SDS and 3 units of Proteinase K (New England Biolabs, #P8107S), and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng of vector and 150 ng of each fragment were mixed with 3 μl of HiFi DNA Master Mix (NEB) and incubated at 50°C for 1 hour to form the new pCDH-TagBFP-T2A-myc-BirA*-Tensin3 construct ...
-
bioRxiv - Neuroscience 2022Quote: ... Mutation of the verified 7-mer binding site of the 3’-UTR of Zfp36l1 was performed using the Q5-site directed mutagenesis kit (New England BioLabs) using the following primers ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... was combined with forward and reverse primers (Supplementary Table 3) and the Luna Universal qPCR Master Mix master mix (M3003, NEB) containing SYBR green and ROX passive dye to a final 10ul reaction volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2019 [36] with the modification that 3 µg of gDNA per technical replicate were digested using Nucleoside Digestion Mix (NEB M0649S ...
-
bioRxiv - Molecular Biology 2022Quote: The regions of interest (supplementary Table 1) were PCR amplified (supplementary table 3) from the extracted DNA using Q5 high-fidelity DNA polymerase (NEB). Of the primers used in the PCRs (supplementary table 2 ...
-
bioRxiv - Physiology 2022Quote: ... while an additional step which added 3’ A-overhangs to the slc15a2a purified PCR product was performed using Taq DNA polymerase (New England Biolabs) before cloning into pCR4-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Biochemistry 2020Quote: ... the human Rab1b 3-174aa (referred to as Rab1b)-encoding DNA was cloned into a modified pMAL vector (New England Biolabs), resulting in a construct with a N-terminal hexahistidine (6xHis ...
-
bioRxiv - Plant Biology 2021Quote: ... the RNA was subsequently ligated to an RNA adapter with a 3’ phosphate group by RtcB ligase (#M0458S, New England Biolabs). The ligated RNA was converted to cDNA with RevertAid first strand cDNA synthesis kit (#K1612 ...