Labshake search
Citations for New England Biolabs :
2901 - 2950 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and 1 IU Taq DNA polymerase (NEB). For detailed information on primer sequences and PCR conditions see Supplementary Information Table S2.
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μl Taq DNA polymerase (NEB) with incubation at 37°C for 15 minutes followed by 72°C for 5 minutes.
-
bioRxiv - Biochemistry 2023Quote: ... and Anti-MBP (NEB E8032S, 1:10000). Secondary antibodies include IRDye 680RD goat anti-rabbit (LI-COR 926-68071 ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl RNase H (New England BioLabs), 1 μl 10X RNase H Reaction Buffer ...
-
bioRxiv - Biophysics 2023Quote: ... 1 μL RNase H (New England Biolabs) was added to the mixture to digest the RNA ...
-
bioRxiv - Genomics 2023Quote: ... 1 μL of 10X CutSmart buffer (NEB), and NFW for a total reaction volume of 10 μL ...
-
bioRxiv - Physiology 2023Quote: ... 1 µl dNTP Mix (New England BioLabs), 1 U of Phusion® Hot Start II High-Fidelity DNA polymerase (New England BioLabs) ...
-
bioRxiv - Systems Biology 2023Quote: ... 1% (v/v) RNase inhibitor (NEB, M0314S) and 10% (w/v ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube A (NEB), 1 µl Exo-CIP Tube B (NEB ...
-
bioRxiv - Genomics 2023Quote: ... Blocking was achieved using 1% BSA (NEB) and 0.1% Tween-20 in 1× PBS for 1 h at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... and T4 ligase (30 U.μL-1, NEB) and incubated at 25°C for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1× RNaseH Reaction Buffer (NEB Japan) at 37 ℃ overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μU ml-1 lambda phosphatase (NEB), and 25 μU ml-1 apyrase (NEB)] ...
-
bioRxiv - Plant Biology 2024Quote: ... cut with 1 unit of BpiI (NEB) at 37 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Torin at 1 µM (New England Biolabs), and Bafilomcyin at 10 nM (Sigma) ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 1 (New England Biolabs #B7030) at 30°C for 1 hour followed by column purification ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× Q5 reaction buffer (New England Biolabs), 200 µM dNTPs (Thermo Fisher Scientific ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... in 1× T4 DNA ligase buffer (NEB). Samples were column-purified using RNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Genetics 2024Quote: ... and 1× Q5 buffer (New England Biolabs). Thermal cycling was performed as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL T4 PNK (NEB, #M0201L) for 30 to 60 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 1× T4 DNA ligase buffer (NEB) for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 IU Taq DNA polymerase (NEB). For detection of KPNA2 mRNA a forward primer in exon 1 (5’-GAA GGG TAG CAG ACG TTT CC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... and T4 RNA Ligase 1 (NEB, #M0204S), respectively ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL T4 DNA ligase (NEB M0202M), 15 μL nuclease-free water ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 unit of Phusion DNA Polymerase (NEB), as well as 10 pg of a pD-template ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 1 volume of λ-Phosphatase (NEB) with 1 volume of water ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL Dnp1 restriction enzyme (NEB, #R0176S) was added to the PCR mixture and the sample incubated at 37 °C for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 µL of 20 mg/mL BSA (New England Biolabs) and 3.5 µL of 5 Weiss U/µL T4 DNA Ligase (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... The supernatant was applied to 6 ml amylose resin (NEB) at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 6 U SalI (New England Biolabs, Cat. No. R0138S)) were incubated with the following condition ...
-
bioRxiv - Molecular Biology 2020Quote: ... the 3’ adapter was first ligated using 0.5 μl of 3’SR Adapter for Illumina (NEB-kit) added to 30 ng of input RNA diluted in 3.0 μl nuclease free H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... The antisense strand with a 3′ phosphate was radiolabeled by T4 Polynucleotide Kinase (3’ phosphatase minus) (NEB) and [γ-32P]ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...