Labshake search
Citations for New England Biolabs :
2851 - 2900 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 5 μl of genomic DNA was used with Luna Universal qPCR Master Mix (NEB) and primers for the R ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 5 µl of collection buffer (NEBNext Single Cell Lysis Module, New England Biolabs). Noteworthy ...
-
bioRxiv - Genomics 2023Quote: ... around 5 million cross-linked nuclei were digested overnight using 400 U DpnII (NEB). After digestion ...
-
bioRxiv - Genomics 2023Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... The DNA/RNA hybrid strand was pre-adenylated with DNA 5’ Adenylation Kit (NEB) and purified with Oligo Clean & Concentrator (Zymo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... A volume of 40 μl reaction mix containing 5 μl isothermal amplification buffer (NEB), 3 μl 100 mM MgSO4 ...
-
bioRxiv - Genetics 2023Quote: ... 5% DMSO and 1× NEBNext High-Fidelity PCR master mix (New England BioLabs, M0541L) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Injection mixtures contained 10μl restriction digest including 5 units of I-SceI enzyme (NEB), 1μl CutSmart buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µg of genomic DNA from the clones were digested solely with XhoI (NEB) overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... which was purified directly over Monarch DNA Cleanup Columns (5 μg) (New England Biolabs) using a 10:1 ratio of binding buffer (a modified version of Qiagen’s PB buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 5% (v/v) DMSO and 0.5 U Phusion High-Fidelity DNA polymerase (NEB, M0530S). Cycling was performed using the following thermocycler settings ...
-
bioRxiv - Genetics 2023Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... All the produced constructs were propagated in competent cells (5-alpha Competent E.coli; NEB) and isolated by NucleoSpin Plasmid (TaKaRa) ...
-
bioRxiv - Genomics 2023Quote: ... RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark ...
-
bioRxiv - Immunology 2023Quote: ... 5 µg of sequencing verified plasmid were restriction digested using BsmBI V2 (NEB, #R0739S) in a 50 µl reaction with NEB3.1 buffer (NEB ...
-
bioRxiv - Genetics 2024Quote: ... along with an additional 5 µL 2x Gibson Assembly Master Mix (NEB Cat#E2611L). The reaction mixture was incubated at 50°C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs, E6111L), and 0.25 uL of mRNA Second Strand Synthesis enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 μL Quick-Load pBR322 DNA-MspI Molecular Marker (New England Biolabs Inc.) in a separate lane ...
-
bioRxiv - Biochemistry 2024Quote: ... The assembly reaction was transformed into NEB 5-alpha competent cells (New England Biolabs). After the recovery step ...
-
bioRxiv - Microbiology 2024Quote: 5’ RACE was done using a Template Switching (TS) Reverse Transcriptase Enzyme mix (NEB) that takes advantage of a template switching reverse transcriptase and a template switching oligonucleotide (TSO) ...
-
bioRxiv - Genomics 2024Quote: ... RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... RNA and 3′ adapters were incubated at 22°C for 2.5 hr with 51 U of T4 RNA Ligase I (NEB) and 12 U of recombinant RNase inhibitor (Takara Bio ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragment was ligated into the pLSV101 vector (3:1 molar ratio) with T4 DNA ligase (New England Biolabs) (16 °C overnight) ...
-
bioRxiv - Neuroscience 2019Quote: Single nucleus RRBS were performed by first sorting PROX+/FOS+ and /FOS- neuronal nuclei in 96-well plates in 3 µL of 0.1× CutSmart buffer (New England Biolabs) per well as described in the Flow Cytometry section of the Materials and Methods ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Genetics 2022Quote: ... Pddx-23::ceDDX23::ddx-23 3’UTR (nEx2971 and nEx2972) was generated by HiFi DNA Assembly (New England Biolabs) of Pddx-23 ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2021Quote: ... the THN gene was ligated to pICH41021 in a 3:1 molar ratio using T4 Ligase (New England Biolabs) at 4°C overnight and transformed by heat shock into chemically competent E ...