Labshake search
Citations for New England Biolabs :
2701 - 2750 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 ug from each cell line was digested with 25 units EcoRI (New England Biolabs) in 100 ul total volume ...
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This fragment was generated by a standard 3-step PCR protocol using Phusion DNA polymerase (New England Biolabs) and then cloned into the XbaI and HindIII sites of pEX18A (Prentki and Krisch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragmented RNA was then subjected to RNA 3’ linker ligation using T4 RNA Ligase I (New England Biolabs) and reverse transcription using a primer complementary to the linker sequence and SuperScript III (ThermoFisher ...
-
bioRxiv - Bioengineering 2020Quote: ... and the 3’ extension were ligated together into the digested vector using Quick Ligase or T4 Ligase (NEB) to generate the complete pegRNA plasmid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Genomics 2021Quote: ... Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S), and checked for reaction completion by running on agarose gel ...
-
bioRxiv - Genetics 2020Quote: ... the mutant Tile 3 was subcloned into the full length AttB-KCNH2-HA:IRES:mCherry by restriction digest with BglII and NdeI (NEB) and ligation with T4 ligase (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: Ligation workups from the previous step were supplemented with 3 μL of 6X purple gel loading dye (NEB), heat denatured at 85 °C for 1 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the previously constructed genome-integrating vector pCS75 (25) (Supplementary Table 3) was cleaved with PmeI and EagI (NEB), the resulting fragments were separated on a 0.8% agarose gel ...
-
bioRxiv - Genomics 2024Quote: ... 3.) Library preparation was performed using the NEBNext Ultra II library preparation kit for Illumina (New England Biolabs) and 4. ...
-
bioRxiv - Microbiology 2024Quote: ... 1.25 µL native ligation barcode (ONT SQK-NBD114-96) and 3 µL Blunt/TA Ligase Master Mix (NEB). The reaction was mixed by pipetting ...
-
bioRxiv - Cell Biology 2023Quote: Ifnb1 mRNA 3’ UTR (NM_002176.4) was synthesized using the HiScribe T7 High Yield RNA synthesis kit (NEB, E2040S) through in vitro transcription ...
-
bioRxiv - Genomics 2023Quote: ... nick ligation was then performed in a 30 µL reaction with 3 µL of 10x rCutSmart Buffer (NEB), 1.56 µL of 500 µM β-Nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 3’ A-addition and adapter ligation using a custom reagent formulation (New England BioLabs, E6000B-10). Libraries were pooled in equal molar amounts and were sequenced using an Illumina HiSeqX platform (Ilumina ...
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Developmental Biology 2023Quote: ... At least 3 sgRNAs per gene were cloned using ssDNAs oligoes (IDT) and NEBuilder HiFi DNA Assembly (NEB) into modified backbone ...
-
bioRxiv - Microbiology 2023Quote: ... The 3′ ends of purified RNA were dephosphorylated with the addition of T4 PNK enzyme (New England Biolabs) and 10 mM ATP was added to phosphorylate the 5’ ends of the RPF (ribosome protected fragments) ...
-
bioRxiv - Microbiology 2023Quote: Purified vigR 3’ UTR amplified from JKD6008 was in vitro transcribed (IVT) using HiScribe T7 RNA polymerase (NEB). RNA products were DNase I treated (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation of the RNA 3’ Adapter (RA3) was achieved by using T4 RNA Ligase 1 (NEB, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligations were transformed into high efficiency (1-3 × 109 CFU/μg pUC19 DNA) competent cells (NEB C3040). The transformations were serially diluted and plated on LB with ampicillin (100 μg/ml) ...
-
bioRxiv - Genomics 2023Quote: ... CBS 112042+ and CBS 124.78+ were sequenced on R9.4.1 flowcells using the LSK108 kit with 3 μg DNA as input for the end prep reaction (NEB ULTRA-II EP ...
-
bioRxiv - Microbiology 2024Quote: ... 3 μL of a ligation mixture containing 0.01 U of Bst 2.0 DNA polymerase (NEB, Ipswich, MA, USA), 0.5 U of SplintR ligase (NEB ...
-
bioRxiv - Neuroscience 2024Quote: After washed with 0.1 3 SSC buffer (Thermo, AM9770) supplemented with 0.05 U/ml RNase inhibitor (NEB, M0314L), tissue sections placed on the chip were permeabilized using 0.1% pepsin (Sigma ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterwards 2 µg of recombinant human Histone H3.1 (New England BioLabs, M2503), 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...