Labshake search
Citations for New England Biolabs :
2601 - 2650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... flies and inserted into the XbaI and XhoI sites of pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (addgene #36432) via Gibson assembly (NEB). The resultant plasmid was injected into the D ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and a 1.8 kb backbone using Gibson Assembly (NEB). T2A was initially introduced using a gBlock (IDT ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... amplified by PCR with Phusion DNA polymerase (NEB) with RBNS index primers and RBNS reverse primer I (see below) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2011) at the University of Wisconsin-Madison Biotechnology Center with the ApeKI enzyme (New England Biolabs) from ∼50 ng of genomic DNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... four sequencing libraries were generated by NEBNext® Ultra ™II DNA Library Prep Kit for Illumina ® (NEB, Ipswich, MA). Sizes and concentrations of the sequencing libraries were again verified by the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Evolutionary Biology 2024Quote: We prepared the DNA extracts into sequencing libraries following the NEBNext Ultra II FS DNA Library Prep Kit (NEB) according to manufacturers’ instructions but replaced the NEBNext Adapters with Y-Adapters ...
-
bioRxiv - Evolutionary Biology 2024Quote: RNA was extracted from heads and thorax+abdomen of one female and one male using the Monarch Total RNA Miniprep Kit (New England, BioLabs). RNA was purified by ethanol precipitation and equal concentration of head and thorax+abdomen tissue was pooled for sequencing ...
-
bioRxiv - Genomics 2024Quote: ... Ultra FS II library kit (New England BioLabs, Ipswich, MA) was used ...
-
bioRxiv - Genomics 2024Quote: ... BsmBI-v2 (NEB R0739S) digest at 55°C for 6 hr ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL of Q5 High Fidelity Polymerase (New England Biolabs M0491L), 40.25 µL of nuclease-free water ...
-
bioRxiv - Genomics 2024Quote: ... by including a tevopreQ1 motif,40 we first inserted a DNA duplex annealed from DNA oligos (5′-CGCGCCCGTCTCACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAATTTTTTTC, 5′-TCGAGAAAAAAATTCTAGTTGGTTTAACGCGTAACTAGATAGAACCGCGTGAGACGGG) into pJY127 digested with AscI (NEB R0558S) and XhoI ...
-
bioRxiv - Genomics 2024Quote: ... a SYBR green I based qRT-PCR kit (Luna Universal One-Step NEB, Ipswich, USA) was used in PCR mixtures (20 µl ...
-
bioRxiv - Genomics 2024Quote: ... Vector backbone pAC026 was subjected to a BstXI-BlpI (NEB R0585S) double digest at 37°C for 4 hr followed by SPRI purification ...
-
bioRxiv - Genomics 2024Quote: ... Digested oligo pool and vector backbone were ligated using T4 DNA Ligase (NEB) at room temperature for 45 min and purified using SPRI ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... extracted DNA was amplified using a two-stage Phusion High-fidelity DNA polymerase PCR (NEB). In a three-cycle PCR ...
-
bioRxiv - Genomics 2024Quote: ... This intermediate backbone (pJY127) was then digested with BamHI (NEB R0136S) and NotI (NEB R0189S) ...
-
bioRxiv - Genomics 2024Quote: Extracted samples were DNase treated (NEB, Ipswich, USA) to eliminate any residual DNA molecules from the host in the RNA extracts ...
-
bioRxiv - Genomics 2024Quote: ... Amplified oligo pool was double digested with BstXI and BsaI-v2 (NEB R3733S) restriction enzymes at 37°C for 4 hr and purified through column clean-up ...
-
bioRxiv - Genomics 2024Quote: ... The purified scaffold insert (2 ng) was ligated with the digested intermediate plasmid library vector (200 ng) using T4 DNA Ligase (NEB) at room temperature for 45 min ...
-
bioRxiv - Genomics 2024Quote: ... and NotI (NEB R0189S), and a DNA duplex annealed from DNA oligos (5′-GATCCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACGC ...
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Genomics 2024Quote: ... were inserted into the KpnI-digested (#R3142S, NEB) pU6_pegRNA-GG-Acceptor plasmid via Gibson assembly.
-
bioRxiv - Evolutionary Biology 2024Quote: Plasmids carrying the gfp reporter under the control of different versions of hisJ promoter were constructed using the NEBuilder HiFi DNA Assembly (NEB). Primers used to amplify the backbone or the promoter regions from the evolved bacterial lines are reported in the primer list ...
-
bioRxiv - Genomics 2024Quote: ... which had been digested with EcoRI and XbaI (#R0145S & #R3101S, NEB). Single pegRNAs were stably integrated using lentiviral vectors cloned by assembling pegRNA oligo duplexes into BsmBI-digested (#R0739L ...
-
bioRxiv - Genomics 2024Quote: ... ligated with a hairpin adaptor (NEB), treated with USER enzyme (NEB ...
-
bioRxiv - Genomics 2024Quote: ... Gibson assembly reactions to create these plasmids were performed using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621L).
-
bioRxiv - Genomics 2024Quote: ... Gap-repaired tagmented DNA was treated with USER enzyme (NEB) and T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... via insertion of spacer sequences into the BbsI cloning site (#R3539L, NEB). Supplementary Table 9 contains sequences for all oligos used in this study.
-
bioRxiv - Genomics 2024Quote: ... followed by dephosphorylation with Quick SAP (NEB). gRNAs were re-folded prior ABE8e:gRNA complexation ...
-
bioRxiv - Genomics 2024Quote: ... amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs). The intronic sequence encompassing the USH2A:c.7595-2144 location was introduced in the recipient pSPL3 exon trapping vector ...
-
bioRxiv - Genomics 2024Quote: ... Lambda exonuclease (NEB), Exonuclease I (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... gap repaired with HiFi HotStart Uracil+ Ready Mix (Kapa) and Taq DNA ligase (NEB), and treated with a mixture of USER enzyme and T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... Intramolecular circularization of the DNA was performed with T4 DNA ligase (NEB) and residual linear DNA was degraded by a cocktail of exonucleases containing Plasmid-Safe ATP-dependent DNase (Lucigen) ...
-
bioRxiv - Genomics 2024Quote: ... and the processed RNA samples were used to construct RNA-seq libraries using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA). Then the RNA libraries were sequenced using the Illumina HiSeq 4000 platform to generate 150bp paired-end reads ...
-
bioRxiv - Genomics 2024Quote: ... CD7 or PDCD1) were amplified from T cell genomic DNA using 2X Phusion Hot Start Flex Master Mix (NEB) (primers described in Supplementary Table 3 ...
-
bioRxiv - Genomics 2024Quote: ... Endonuclease V-treated DNA molecules were end-repair with Klenow exo-(NEB), A-tailed ...
-
bioRxiv - Genomics 2024Quote: ... The nodule-derived RNA was treated with NEBNext rRNA Depletion Kit (Bacteria) (NEW ENGLAND BioLabs) and RiboMinus Plant Kit for RNA-Seq (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... ligated with a hairpin adapter (NEB), treated with USER enzyme and amplified by PCR using HiFi HotStart Uracil+ Ready Mix (Kapa/Roche) ...
-
bioRxiv - Genomics 2024Quote: ... Exonuclease I (NEB), Plasmid-Safe ATP-dependent DNase (Lucigen ...
-
bioRxiv - Genomics 2024Quote: ... Lambda exonuclease (NEB) and Exonuclease I (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... and the wild-type (USH2A:c.7595-2144A) minigene plasmids were generated by Q5® High-Fidelity DNA Polymerase (New Englands Biolabs) amplification of the target USH2A region using gDNA of a human heterozygous USH2A:c.7595-2144A/G patient and subsequent cloning into the pSPL3 backbone vector by NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs) ...
-
bioRxiv - Genomics 2024Quote: ... and Exonuclease III (NEB), to enzymatically degrade remaining linear DNA molecules ...
-
bioRxiv - Genomics 2024Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (NEB), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... NEB buffer 3.1 (NEB) and 270 nM of gRNA ...
-
bioRxiv - Genomics 2024Quote: ... Single pegRNAs were stably integrated using lentiviral vectors cloned by assembling pegRNA oligo duplexes into BsmBI-digested (#R0739L, NEB) Lenti_gRNA-Puro (Addgene #84752) ...
-
bioRxiv - Genomics 2024Quote: ... and Exonuclease I (NEB). In vitro cleavage reactions were performed with 125 ng of exonuclease-treated circularized DNA ...
-
bioRxiv - Genomics 2024Quote: ... DNA was circularized at a concentration of 5 ng/µl with T4 DNA ligase (NEB), and treated with a cocktail of exonucleases ...
-
bioRxiv - Genomics 2024Quote: ... and treated with a mixture of USER enzyme and T4 polynucleotide kinase (NEB). DNA was circularized at a concentration of 5 ng/µl with T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2024Quote: The Zhang Lab General Cloning Protocol was used to insert annealed synthetic-oligonucleotide gRNA into the BbsI (New Englands Biolabs) restriction site to clone single gRNAs into PX458 and EDCas9 ...
-
bioRxiv - Genomics 2024Quote: ... followed by Endonuclease V (NEB) treatment ...