Labshake search
Citations for New England Biolabs :
2551 - 2600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... were PCR-amplified by Q5® High-Fidelity DNA Polymerase (New England Biolabs) using plasmid L5 attB::Pleft*mScarlet/mWasabi (Addgene plasmids 169410 and 169409 ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Microbiology 2024Quote: ... the BAC replicon-encoding DNA was first linearized with SwaI (New England Biolabs), and then purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Microbiology 2024Quote: ... using 0.5 µl of Q5 HF DNA polymerase (New England Biolabs), 10 µM of dNTPs (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... 5 units (2.5 μL) of RNase free DNAse I (NEW ENGLAND BioLabs, 2000 u. mL-1) and 100 μL of nuclease free water was added for every 10 μg of RNA ...
-
bioRxiv - Microbiology 2024Quote: ... and pNJ-26 vector were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB), to generate the plasmid pSAG1:EGFP-DHFR-BAG1:mCherry ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adaptor ligation was performed with a 1:10 dilution of adaptor (NEB, E6440S). For DNA purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Klenow (NEB, M0210M) and then A-tailed using Klenow (exo- ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA ends were then blunted using T4 DNA polymerase (NEB, M0203L) and Klenow (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3’ ends were dephosphorylated using T4 PNK (NEB, M0201). DNA ends were then blunted using T4 DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA-DNA chimeras were digested with MmeI (NEB, R0637L) in a reaction containing a double-stranded oligonucleotide with an MmeI site (IDT ...
-
bioRxiv - Molecular Biology 2024Quote: DNA libraries were prepared according to the manufacturer’s protocol (NEBNext® Ultra II, NEB) with some minor adjustments for CUT&RUN samples ...
-
bioRxiv - Genomics 2024Quote: ... Double-stranded DNA libraries with 450 bp insert size were prepared using the ultraFS-II kit (New England Biolabs, London, United Kingdom). The QC check for the prepared libraries was done on an Agilent Tapestation (Santa Clara ...
-
bioRxiv - Genomics 2024Quote: Hadrurus arizonensis DNA was extracted using the MonarchⓇHigh Molecular Weight (HMW) DNA Extraction Kit: Tissue Protocol (NEB, T3060). Changes made to the protocol include ...
-
bioRxiv - Genomics 2024Quote: ... New England BioLabs (NEB) Ultra FS II library kit (New England BioLabs ...
-
bioRxiv - Genomics 2024Quote: ... Two genomic library protocols were prepared for each (NEB and iNextEra ...
-
bioRxiv - Molecular Biology 2024Quote: ... were used to generate gRNA using the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB) and purified using the RNeasy Mini Kit (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: High molecular weight genomic DNA was extracted from homozygous hDMDTg and hDMDTgSc mice liver using the Monarch HMW DNA Extraction Kit for Tissue (NEB). Oxford Nanopore Technologies Promethion genome sequencing was performed as a service by Novogene ...
-
bioRxiv - Genomics 2024Quote: ... Plasmid DNA were extracted from bacterial cultures using Monarch Plasmid Miniprep Kit (New England Biolabs) and sequenced using the BigDye Terminator v.1.1 kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was prepared after polyA mRNA selection using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB). Sequencing was performed on Illumina NovSeq600 using a 2×150 paired end configuration ...
-
bioRxiv - Genomics 2024Quote: Base editor mRNAs were generated by in vitro transcription using the HiScribe T7 High-Yield RNA synthesis kit (NEB Cat No. E2040S) via the method described in48 ...
-
bioRxiv - Genomics 2024Quote: NEBuffer 2 (New England Biolabs, cat. no. B7002)
-
bioRxiv - Genomics 2024Quote: Proteinase K (New England Biolabs, cat. no. P8107)
-
bioRxiv - Genomics 2024Quote: Klenow Fragment (exonuclease-deficient; New England Biolabs, cat. no. M0212)
-
bioRxiv - Neuroscience 2024Quote: ... the construct was diluted 1:5 with empty pUC19 vector (New England Biolabs) and then transfected with 7.5 µL of TransIT-293 and 2.5 µg of DNA ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). Resulting plasmids were verified by sequencing (GeneWiz).
-
bioRxiv - Evolutionary Biology 2024Quote: ... the genomic region of interest were firstly amplified by PCR (Q5-NEB), and the products were purified using the DNA Clean & Concentrator kit (Zymo Research) ...
-
bioRxiv - Neuroscience 2024Quote: ... the vector was linearized by double digestion using restriction enzymes (New England Biolabs). DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs) ...
-
Modular structure of RNA 3’ processing condensates involving the Arabidopsis RNA binding protein FCAbioRxiv - Molecular Biology 2024Quote: ... NdeI and XbaI (NEB) overnight ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we added 1 uL of T4 DNA ligase buffer (New England Biolabs, USA, product #B0202S). Using a thermal cycler (C1000 Touch Thermal Cycler ...
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid obtained by PCR was ligated using the KLD enzyme mix (NEB cat # M0554S) according to the manufacturer’s protocol before transformation ...
-
bioRxiv - Microbiology 2024Quote: LT area was amplified from 12-week gDNA with PCR using Q5 High-Fidelity DNA Polymerase (NEB) and cloned to pUC19 vector to BamHI/HindIII site ...
-
bioRxiv - Microbiology 2024Quote: ... The prepared RNA was reversely transcribed with Protoscript II Reverse Transcriptase (NEB, M0368) using random primers from the kit.
-
bioRxiv - Microbiology 2024Quote: ... template genomic DNA was prepared by picking one colony into 50 μL ThermoPol buffer (NEB) with 0.5 μL thermolabile Proteinase K (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... with 0.5 μL thermolabile Proteinase K (NEB), incubating at 37°C for 30 min and inactivating the protease at 55°C for 10 min.
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were assembled using isothermal HiFi assembly (New England Biolabs (NEB), Ipswitch ...
-
bioRxiv - Microbiology 2024Quote: ... 20 mM MgCl2 and digested with 10 μg DNAse I (NEB) and 50 μg RNAse (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Clones were genotyped with outside-outside colony PCR with NEB OneTaq (New England Biolabs (NEB), Product No ...
-
bioRxiv - Microbiology 2024Quote: ... Clones were genotyped with outside-outside colony PCR with NEB OneTaq (New England Biolabs (NEB), Product No ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were assembled using isothermal HiFi assembly (New England Biolabs (NEB), Ipswitch ...
-
bioRxiv - Microbiology 2024Quote: ... Successful mutagenesis was confirmed by PCR with Q5 or Taq DNA polymerase (NEB). For this ...
-
bioRxiv - Microbiology 2024Quote: ... Primers with overhanging sequences homologous to either 5’ or 3’ end of target gene fragments were used to linearize pMCSG53 expression vectors at the multiple cloning sites through PCR reactions (Q5 High-Fidelity 2X Master Mix, New England Biolabs). Amplicons were subsequently gel-extracted (Wizard SV Gel and PCR Clean-Up System ...
-
bioRxiv - Microbiology 2024Quote: ... then incubated with 5 units of Antarctic phosphatase (NEB) at 37°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was conducted using Q5 polymerase (NEB) following manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... and combined with corresponding gene inserts in Gibson reactions (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs) to allow integration of targeted genes ...
-
bioRxiv - Microbiology 2024Quote: ... OneTaq polymerase with high-GC buffer (NEB) was used for colony PCR screening.
-
bioRxiv - Microbiology 2024Quote: ... and ligated with T4 ligase (NEB). E ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were resolved on SDS-PAGE gels alongside a Blue Protein Standard Broad Range ladder (New England BioLabs). Bands were transferred onto nitrocellulose membranes and were blocked with a 5% (w/v ...
-
bioRxiv - Microbiology 2024Quote: Approximately 40mg of feces were used for RNA extraction using the Monarch® Total RNA Miniprep Kit (New England Biolabs, NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... using the Q5 High-Fidelity 2X Master Mix (NEB). The resulting PCR products were sequenced as mentioned above for the screening but using a Flow Cell R10.4.1 (ONT) ...