Labshake search
Citations for New England Biolabs :
201 - 250 of 1950 citations for C Reactive Protein Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... including protein disulfide bond enhancer (NEB) and GamS (NEB) ...
-
bioRxiv - Microbiology 2023Quote: Protein expression vector pMAL-c5Xa (NEB) was used as the backbone for constructing the mCherry reporter ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein markers (New England Biolabs, #P7719S) were used for molecular mass determination.
-
bioRxiv - Microbiology 2023Quote: ... proteins were deglycosylated by PNGaseF (NEB) prior to gel electrophoresis to facilitate analysis.
-
bioRxiv - Cell Biology 2023Quote: ... and Protein Kinase A (NEB, P6000S) were purchased from New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... 2 µl Cas9 Protein (M0386, NEB), 0.5µl buffer (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... including 2.5-4 min fragmentation at 94⁰C (NEB).
-
bioRxiv - Microbiology 2019Quote: DNase I (20U, 30 min, 37°C, NEB M0303S) and RNAse A (100 μg ...
-
bioRxiv - Bioengineering 2023Quote: ... at 25 °C for SmaI (New England Biolabs, R0141), and at 37 °C for MscI (New England Biolabs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2mL of 37°C SOC Recovery Medium (NEB #B9020) were added to the cuvette ...
-
bioRxiv - Microbiology 2023Quote: ... C-tailing was performed with Terminal Transferase (NEB #M0315) and 400-800 ng of end repaired gDNA using a 1:20 dCTP:ddCTP mixture (9.5 mM dCTP Millipore Sigma #3732738001 ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Bioengineering 2020Quote: ... Respective peptide DNA coding sequences (CDS) were amplified from hACE2 via PCR and inserted using HiFi DNA Assembly Master Mix (NEB) for Gibson Assembly into the pcDNA3-SARS-CoV-2-S-RBD-Fc backbone linearized by digestion with NheI and BamHI ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3-FLAG-PKCα constructs expressing FLAG-tagged PKCα were generated by amplifying the coding region of PKCα from HeLa Tet-off cell total RNA and inserting it into pcDNA3-FLAG (45) immediately downstream of the FLAG peptide sequence using Gibson Assembly (NEB). Constitutive active PKCα-AE was generated by mutating alanine 25 into glutamic acid ...
-
bioRxiv - Developmental Biology 2022Quote: ... and zebrafish cachd1 ectodomain production constructs (ectodomain fused to hexahistidine and BirA ligase peptide substrate tags) were prepared by NotI/AscI restriction enzyme double digest (New England Biolabs) of pTT3-based vector backbones (50 ...
-
bioRxiv - Molecular Biology 2019Quote: 100µM of the synthesized phosphopeptides (Aapptec) or non-phosphorylated peptides were incubated with 350units of recombinant GSK3β (New England Biolabs) and cold kinase buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... The lyophilized peptides were resuspended in 200 µl of 50 mM ammonium bicarbonate to which 3 µl of PNGaseF (New England Biolabs) were added for a 4h incubation at 37C ...
-
bioRxiv - Plant Biology 2022Quote: ... a YFP sequence was inserted just after putative endoplasmic reticulum signal peptide sequences in LTPG1 and LTPG2 using the homologous recombination Gibson Assembly system (New England Biolabs), according to Kim et al ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides obtained by trypsin digestion were subsequently labeled as directed by the tandem mass tag (TMT) kit (PTM Biolabs). The labeling peptides were then fractionated by high pH reverse-phase high-performance liquid chromatography and further subjected to liquid chromatography with tandem mass spectrometry (LC-MS/MS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coding sequences for mouse Gata4 and E2-Crimson preceded by an E2A self-cleaving peptide (E2A-E2-Crimson) were assembled using NEBuilder HiFi DNA assembly (NEB) to generate pCX-Gata4-E2A-E2-Crimson ...
-
bioRxiv - Cancer Biology 2023Quote: 20 μL of the lysate DNA containing the peptide library was PCR amplified with Q5 high-fidelity DNA polymerase (New England Biolabs), for 15 cycles in a 50 μL reaction ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Plant Biology 2020Quote: ... The NRPD1-Maltose Binding Protein (MBP) fusion protein was affinity purified using Amylose resin (New England Biolabs) and eluted with 20 mM maltose ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Zoology 2024Quote: ... Proteins were purified from cell lysates using the pMAL protein fusion and purification system (New England Biolabs). The MBP protein was also independently expressed in pMAL-c2x as control ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 5’ phosphorylated 3’ end adapter featuring 4 randomized nucleotides at the 5’ terminus and a 3’ blocking group (3C Spacer; 3SpC3, IDT) underwent adenylation using Mth RNA ligase (New England Biolabs, cat# M2611A). Adapters were subsequently ligated to deacylated and demethylated RNA templates using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Immunology 2019Quote: ... activated and transduced T cells were incubated with GXR-B27 cells pulsed with the indicated peptide concentrations for 6 hours in presence of Brefeldin A (NEB; 420601). The cells were stained with anti-LNGFR-PE ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Molecular Biology 2023Quote: ... peptide sequences specific to an aMino sdAb were generated using the Ph.D.™-C7C Phage Display Peptide Library Kit (New England BioLabs, E8120S), a combinatorial library consisting of randomized display peptides with a disulphide constrained loop (AC-XXXXXXX-CGGGS ...
-
bioRxiv - Genetics 2024Quote: ... and were assembled together with a fragment encoding mClover3 followed by a 2A peptide and a pUC plasmid digested with PciI (NEB, #R0655) and SbfI (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 μg of purified protein complexes were treated with 2,000 U of Lambda Protein Phosphatase (New England Biolabs) in 200 μl dephosphorylation buffer (50 mM HEPES-NaOH ...
-
bioRxiv - Systems Biology 2023Quote: ... the wild-type protein extracts were incubated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Genomics 2019Quote: ... and SalI-HF (37 °C, 90 min, New England Biolabs). The fragments were column-purified ...
-
bioRxiv - Developmental Biology 2022Quote: ... overnight at 37°C and NEBuilder HiFi Assembly MasterMix (NEB) was used for the assembly of the fragments ...
-
bioRxiv - Pathology 2020Quote: ... at 65⁰C for 2h followed by MspI (NEB R0106) at 37⁰C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... dmGemin2 was fused to a C-terminal Mxe intein (NEB) containing a hexahistidine tag ...
-
bioRxiv - Developmental Biology 2020Quote: ... Kinase assays were performed using recombinant murine c-Abl (NEB). The amounts of GST-fusion protein to add to the reaction were calibrated using western blots of the purification products with mouse anti-NICD (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL of 0.4 µg µL-1 Lys-C (NEB) stock was added (enzyme:substrate ratio of 1:100 w/w ...
-
bioRxiv - Plant Biology 2024Quote: ... and ligated overnight at 16°C (T4 DNA ligase; NEB). The same approach was used for the second deletion (353 bp ...
-
bioRxiv - Bioengineering 2023Quote: ... and at 37 °C for MscI (New England Biolabs, R0534) and BstEII-HF (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... 4°C) and filled in using T4 DNA polymerase (NEB) using manufacturers’ instructions at 12°C for 20 min75 ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) in the presence of 0.2 mM Mg2+-ATP and 1 µCi [γ32-P]ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) and 0.5 mM Mg2+-ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Physiology 2022Quote: ... The Cas9 protein was purchased from NEB. Mixture of sgRNA (100 pg ...