Labshake search
Citations for New England Biolabs :
201 - 250 of 8049 citations for 7 Chloro 1 3 dihydro 1 methyl 5 phenyl 2H benzo 1 4 diazepin 2 one 4 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 1 μL of PaqCI/AarI activator (5 pmol, NEB, S0532S), 1 μL of 10 U PaqCI/AarI (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of rSAP mix (rSAP (1 U, NEB, M0371L) in 1X CutSmart buffer (for MseI/NdeI digestions ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 μL of Klenow DNA Polymerase (5 U/μL, NEB) and 2 μL of T4 PNK (10 U/μL ...
-
bioRxiv - Immunology 2019Quote: ... Three hundred nanograms of genomic DNA was mixed with 3 μl of buffer 4 (NEB), 0.5 μl of UDP-6-N3-Glu (0.3 mM) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM MgCl2) and either 25 nM NudE.1 WT or NudE.1 E64,65Q or NudC WT (NEB). For NAD spike-in kinetics ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µl 100× Protease inhibitor cocktail and 1 µl of CviKI-1 (5 U/100,000 nuclei, NEB R0710S) were added ...
-
bioRxiv - Biochemistry 2022Quote: ... D-loops were deproteinized by adding 2 μL of 5% lithium dodecyl sulfate and 1 μL of 20 mg/mL proteinase K (New England Biolabs), and incubating the mixture at 37°C for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were washed two times in barcode wash buffer (+5 μM each of quenching oligo 1 & 2) and then resuspended in ice cold 1x ThermoPol reaction buffer (NEB) cells were passed through a 40μm strainer and counted ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of one plasmid was digested overnight with 10 units PacI (New England Biolabs) in 20 μL at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: RNA 5’-ends were phosphorylated using 4 µl T4 PNK (NEB, catalog no. M0201) in a solution consisting of 8 µl 10x PNK buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... activation was performed overnight at 4 °C with 5 μg of Factor Xa (NEB) per mg of protein ...
-
bioRxiv - Genomics 2023Quote: The standard HiDEF-seq v2 protocol was followed with the exception of replacing Klenow fragment 3’→5’ exo-polymerase with one of the following: 9.6 U Bst large fragment (NEB), 9.6 U Bst 2.0 (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Genomics 2020Quote: ... 1 mM ATP and 10 mM DTT and with 1 μl (2 U/μl) of RNase H (NEB), 1 μl (3 U/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylated adapters (RRBS-1, RRBS-2; Table 1) were added by ligation using DNA ligase (New England Biolabs). DNA was purified using ratio of 1:1.2 sample to AMPure XP beads ...
-
bioRxiv - Genetics 2021Quote: ... 2nd cDNA strand was again synthesized using a transcript specific primer (either 5’UTR_βG-intron _F or 5’UTR_CMV _F2, Table 4) and Q5 2x master mix (NEB, #M0494). After another round of bead purification ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Genomics 2022Quote: ... 3′ Adapter ligation was done using T4 RNA Ligase 1 (NEB, M0204L). A first binding to streptavidin beads (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Cell Biology 2024Quote: ... The 3′ cDNA adapter was ligated by T4 RNA ligase 1 (NEB) by incubating at 25 °C for 16h ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM DTT) were treated with 3 ul (15 units) RNaseH1 (NEB) or H20 as a control and incubated at 37°C for 2 hr with slight agitation (300 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 μM CaCl2) and digested with 1/100 MNase (New England Biolabs). After addition of 250 µL sonication buffer (90 mM Hepes pH 7.9 ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl of proteinase k (800 units ml-1, NEB) were added and reacted for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2% DMSO and 1 U Phusion high fidelty polymerase (NEB) in 1x buffer provided by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl T7 Endonuclease I (1 U/ul, M0302S, NEB) was added and incubated at 37°C for 1 hr ...
-
bioRxiv - Genomics 2020Quote: ... 1 µl T4 RNA Ligase 2 truncated K227Q (200U; NEB)] was added ...
-
bioRxiv - Genomics 2019Quote: ... and 1 µl of NEBuffer 2 (New England BioLabs #B7002S), then heating in a thermocycler at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Systems Biology 2024Quote: ... and 1 μL of Phusion Polymerase (2 U/μL, NEB) were added and mixed by pipette ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4: 4°C hold) using NEB Next High-Fidelity master mix (NEB) in 25 µl reaction volume using RAD-Marker for/ RAD-Marker rev primers (25 nM each ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Oct-4 (NEB, D7O5Z), Sox2 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ml ScaI (BioLabs), followed by 3 h of incubation with a fresh portion ...
-
bioRxiv - Cell Biology 2019Quote: ... stained with oligo-conjugated WGA at a concentration of 2-5 μg/mL in 1× HBSS with 2000× diluted murine RNase inhibitor (New England Biolabs, M0314L) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Molecular Biology 2021Quote: ... Entry vectors 1-5 were digested with BsaI (New England Biolabs) and ligated into the pGGDestSC-ATG destination vector (addgene #49322 ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation of 5’ linker using T4 RNA ligase 1 (NEB; #M0204S) was conducted after phosphorylating the 5’ end of the pooled fragments with T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... 72 °C for 1 min) × 5] using NEBNext 2xMasterMix (NEB, M0541S) with Ad1_noMX and v2_Ad2.* indexing primers followed by qPCR amplification to determine additional cycle numbers ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2021Quote: One microgram of full-length S protein was treated with 1 μg of FXa (P8010L, NEB), furin (P8077S ...
-
bioRxiv - Neuroscience 2022Quote: ... One microgram (1 μg) total RNA was used as an input for mRNA isolation (NEB E7490S), followed by library preparation using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB E7760) ...