Labshake search
Citations for New England Biolabs :
2401 - 2450 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 5) rabbit pAb (PTM Biolabs, SKU: PTM 313), Butyryl-Histone H3 (Lys 27 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 U/mL RNase Inhibitor (M0314S; New England Biolabs, Ipswich, MA, USA), EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μl of 10X exonuclease I buffer (New England Biolabs B0293S) was then added to each 50 μl reaction to remove unused barcoded primers and incubated at 37°C for 1 hour and then 80°C for 20 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 0.5 μl of Klenow DNA polymerase (5 U/μl NEB M0210)) and incubating in a thermocycler with the following program ...
-
bioRxiv - Biochemistry 2022Quote: ... Ea1174 and AncCDT-5(WAG) were expressed in BL21(DE3) cells (NEB): transformed cells were grown in LB media supplemented with 100 mg/L ampicillin to OD600 ∼0.7 at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation products were then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each IVT product was 5’ capped using Vaccinia Capping Enzyme (NEB-M2080S) following manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2019Quote: ... resuspended in 5 μL of 2X RNA loading dye (New England Biolabs) and heated 5 min at 75° C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1 μl Taq DNA Polymerase (NEB, cat#M0273S, 5 U/μl). 10.1 μl of this mastermix was added to each of the 30 μl amplicon pools and incubated for 30 minutes at 20°C followed by 30 minutes at 65°C and finally cooled to 4°C.
-
bioRxiv - Molecular Biology 2021Quote: ... and phosphorylated at the 5’ termini by T4 Polynucleotide Kinase (NEB, M0201L). The pBluescript plasmid was cut by EcoRV and dephosphorylated by Calf Intestinal Alkaline Phosphatase (CIP ...
-
bioRxiv - Genetics 2020Quote: ... Only 1 U/μl I-SceI enzyme 5 X/μl buffer (NEB) were mixed when co-injecting with the HDR donor ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were treated with RNA 5’ Pyrophosphohydrolase (RppH) (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... such that following digestion (5 units of AvaII (New England BioLabs, R0153) at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... Mutant Csde1 5’UTRs were cloned by Gibson assembly reaction (NEB, E2621S) using mutation containing ssDNA templates with homology arms and two upstream/downstream fragments.
-
bioRxiv - Genomics 2021Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Biochemistry 2021Quote: ... NH4HCO3 (100 mM) and 5 units of alkaline phosphatase (CIP) (NEB, #M0525S) were added and the sample incubated for 2 hours (or 20 min ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (5 ug) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described Smola et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... 5 μL 2x NEBnext High-Fidelity PCR Master Mix (New England Biolabs) and 2.9 μL nuclease-free distilled H2O (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... The 5’ end of the transcript was phosphorylated using PNK (NEB M0201L) and then purified with Trizol (Life Technologies 15596-026) ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL NEBNext 5× Quick Ligation Reaction Buffer (New England Biolabs, UK), and 10 μL of Quick T4 DNA Ligase ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 μL of 800 U/mL proteinase K (New England Biolabs) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation product was then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg purified DNA was digested overnight with HinfI and HaeIII (NEB) at 37°C and resolved on a 1% agarose gel ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μg of total RNA were treated with DNase and CIP (NEB) to remove DNA and all non-capped RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µL T4 DNA Ligase (New England Biolabs, catalog No. M0202). The solution was incubated at 16°C for 4 hours ...
-
bioRxiv - Immunology 2024Quote: ... TAP-PCR reaction was performed using 5 μL of Q5 polymerase (NEB), 5 μL of GC Enhancer (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...
-
bioRxiv - Biochemistry 2024Quote: ... Parental plasmids were digested by adding 5 µL 10x cutsmart buffer (NEB), and 1 µL DpnI (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 15% PEG ...
-
bioRxiv - Microbiology 2023Quote: ... Each 5 uL of the reaction contained 0.5 uL of ATP (NEB), 0.5 uL DTT (1 mM final concentration) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of isolated AAVs were treated with DNAse I (NEB, M0303S) before preparing ten-fold serial dilutions ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Zoology 2023Quote: ... 5 µl consisting of 1x OneTaq® PCR master mix (NEB, USA), 0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% (v/v) T4 DNA ligase at 400 U/μL (NEB #M0202), 5% (v/v ...
-
bioRxiv - Biophysics 2023Quote: ... 2.5 mM MgCl2 and 5 mM CaCl2) and digested by MNase (NEB) for 5 min at 25°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluates containing MBP-fusions were applied to 5 mL amylose resin (NEB) columns and extensively washed with 20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli competent cells (NEB 5-alpha, New England Biolabs, Ipswich, MA, USA) that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT ...
-
bioRxiv - Biochemistry 2023Quote: ... or HpaII + PmlI (1x NEB CutSmart Buffer, 5 U enzyme/μg DNA) for 1h at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA was treated with 5 U of Antarctic Phosphatase (NEB #M0289S) for 1h at 37°C in 20 μl reactions ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...