Labshake search
Citations for New England Biolabs :
2351 - 2400 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 U of DNase I-XT (New England Biolabs, USA) was added into 10 μL of reaction mixture and incubation was extended for 30 min at 37°C to remove the DNA templates ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (2 μL APOBEC reaction buffer (NEB), 0.4 μL APOBEC (NEB) ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... and samples were then individually diluted in NEBuffer 2 (NEB) and fragmented by incubating at 92 °C for 1.5 min ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (2 μL APOBEC reaction buffer (NEB), 0.2 μL APOBEC (NEB) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Cas12a RNP: (13 µl water; 2 µl r2.1 buffer [NEB, Cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 µl T7 RNA Polymerase (New England BioLabs, Ipswich, MA), 5 µl ATP (10 μmol) ...
-
bioRxiv - Systems Biology 2024Quote: ... and 1 μL of Phusion Polymerase (2 U/μL, NEB) were added and mixed by pipette ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of DNA Polymerase I (10U/μL, NEB) were added and mixed by pipetting ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 2 units of Phusion High-Fidelity DNA Polymerase (NEB) in HF Phusion buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 µl of RNase H Buffer (New England Biolabs) was added and incubated at 45°C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were treated with 2 units of Proteinase K (NEB) for 30min ...
-
bioRxiv - Systems Biology 2024Quote: ... and 2 μL of T4 PNK (10 U/μL, NEB) were added ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... Unligated linkers were removed from the reaction by yeast 5’-deadenylase (NEB) and RecJ nuclease (NEB ...
-
bioRxiv - Genomics 2020Quote: ... DNA ends were dephosphorylated by addition of 5 μL rSAP (NEB, M0203) and incubation at 37°C for 45 min ...
-
bioRxiv - Microbiology 2020Quote: ... These DNA fragments were subsequently 5’ phosphorylated using T4 PNK enzyme (NEB), then cloned into a SmaI-cut pUC19 using T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were monophosphorylated on their 5’ ends using T4 polynucleotide kinase (NEB) and either 3 mM unlabeled ATP (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Obtained RNAs were 5’-radiolabelled with T4 polynucleotide kinase (New England Biolabs) and [γ32P] adenosine triphosphate (ATP ...
-
bioRxiv - Molecular Biology 2020Quote: This oligonucleotide was adenylated using the 5’ DNA adenylation kit (NEB, E2610S) as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM EDTA and 40 U/ml RNAse inhibitor (New England Biolabs) at 4 °C for 5 min to remove non-specifically associated proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplex reaction was treated with either 5 units of RNase H (NEB) or 10εg of RNase A (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl of a broad range protein marker (New England Biolabs, #P7708) was run alongside the samples on each gel to estimate the molecular weight ...
-
bioRxiv - Microbiology 2019Quote: ... and the 5’ overhang was filled in with T4 DNA polymerase (NEB). Following purification ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Genetics 2019Quote: ... and 5 μl of 3,000 U/ml T4 DNA polymerase (NEB, M0203L) were added to the tube containing the DNA sample ...
-
bioRxiv - Genetics 2019Quote: ... and 1µl of 5 U/μl large DNA Polymerase I (NEB, M0210L) were added ...
-
bioRxiv - Microbiology 2019Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μL of this reaction mixture were transformed into XL10Gold cells (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated by T4 polynucleotide kinase at the 5’ ends (NEB, Ipswich, MA) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs). The libraries were generated using TruSeq small-RNA adaptors and sequenced using NextSeq500 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1(NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... A mix of 5 µL of 10X NEB2.1 buffer (New England Biolabs), 1.25 µL of 1 mM dATP ...
-
bioRxiv - Cell Biology 2021Quote: ... instead of dCTP and 5 U/μl Klenow fragment Dpol I (NEB) at 37°C for 2 h ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L), and incubated for 4 hours at room temperature with rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was degraded using 5 units RNase H (New England Biolabs M0297) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μl of 10 U/μl T4 polynucleotide kinase (NEB; Cat#: M0201L), 1 μl of 5 U/μl Klenow DNA polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3.6 μl of 5 U/μl Klenow (exo-) (NEB; Cat#: M0212S). The reactions were carried out for 45 min at 37 °C in a PCR machine ...
-
Barcoding and demultiplexing Oxford Nanopore native RNA sequencing reads with deep residual learningbioRxiv - Genomics 2019Quote: ... Each IVT product was 5’ capped using Vaccinia Capping Enzyme (NEB-M2080S) following the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2021Quote: ... Beads were resuspended at 5 µg µl-1 followed by MseI (NEB) digestion according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Dephosphorylated RNA was then 5’ end-labeled with 20U T4 PNK (NEB) and 30μCi [g32-P]ATP (Perkin-Elmer) ...
-
bioRxiv - Microbiology 2021Quote: ... and subsequently 5’-dephosphorylated with Calf intestinal alkaline phosphatase (New England Biolabs). CviAII cuts on a sequence motif ‘CATG’ which is highly frequent on bacterial genomes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31) ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Biophysics 2020Quote: We used in vitro mutagenesis (Q-5 Site-directed Mutagenesis Kit, NEB) to introduce the mutations creating d isoforms using the following primers ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Genomics 2022Quote: ... 5 mM EDTA) supplemented with Proteinase K (New England Biolabs Cat. # P8107S) was added to the beads for both ChIP and input chromatin ...
-
bioRxiv - Molecular Biology 2022Quote: 5’-end 32P-labelled DNA substrates were generated using T4 PNK (NEB) and [ɣ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Neuroscience 2022Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1 (NEB)(Hetzel et al. ...
-
bioRxiv - Genetics 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNextµltra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...