Labshake search
Citations for New England Biolabs :
2251 - 2300 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... A second DNA adapter (containing a random-mer of 10 (N10) random bases at the 5′ end) was then ligated to the cDNA fragment 3′ end (T4 RNA Ligase, NEB) in the presence of a high concentration of PEG8000 and dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each of the synthesized DNA fragments was amplified by PCR and inserted at the 5’ of the GFP gene in the pPha-NR vector (NovoPro Bioscience) using NEBuilder HiFi DNA Assembly (New England BioLabs). Five μg of the pPha-NR constructs were introduced into P ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were genotyped by sequencing PCR products using primer vangl2 fwd 5’-ATTCCCTGGAGCCCTGCGGGAC-3’ and primer vangl2 rev 5’-AGCGCGTCCACCAGCGACACAGC-3’ or restriction digest of the PCR products with Alu1 (R0137S, NEB). The vangl2 wild type allele stayed intact while the vangl2vu67 mutant allele was identified by a digested PCR product.
-
bioRxiv - Biochemistry 2024Quote: ... GoldenGate reactions were performed with 5 U of restriction enzyme and 200 U of T4 ligase in T4 ligase buffer (NEB) also containing 0.1 mg/ml BSA (NEB ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... 120 µL 10x T4 DNA ligase buffer and 5 µL of 400 U/µL T4 DNA ligase (New England Biolabs) was added ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... according to manufacturer’s instructions using 100 nM RNA-specific reverse transcription primer followed by RNase H digest with 5 µL RNase H (NEB) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2024Quote: ... and tRNAGln with 5 nt-long 5’ leader and same 24 nt-long 3’ trailer as tRNATyr (5–tRNAGln–24) – were transcribed in reactions containing 1x T7 RNA polymerase reaction buffer (NEB), 0.001% (w/v ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Bioengineering 2024Quote: ... anchored primer was used to create a complementary strand to the TdT extended products using 15 units of Klenow Fragment (3′→5′ exo-) (NEB) in 1× NEB2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Base editing sgRNA directed against the SF3B1 K700 locus was designed using BE-Designer28 and cloned into pLKO.5 Puro-2A-GFP between BsmBI (New England Biolabs) cut sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... the hU6-pegRNA2-polyT cassette was amplified from the pU6-pegRNA-gg-acceptor backbone and ligated into ngRNA1 pLKO.5 Puro-2A-RFP between EcoRI and XhoI (New England Biolabs) to create pLKO.5-K700E-ng1+pg2-Puro-2A-RFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... Adapter sequences were then removed by restriction digest (PCR reaction product, 1X rCutSmart NEB Buffer, 5 U EcoRV-HF (NEB)) at 37°C for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 µl of each PCR product was digested with either 0.5 µl XceI/NspI (for Trim28+/D9; Themo Scientific, FD1474) or 0.5 µl MslI (for Tp53R270H/+; New England BioLabs, R0571L) in a final reaction volume of 30 µl ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of DNA was digested with 50 units of DpnII and 5 μL NEBuffer™ DpnII (NEB, cat #R0543L), in a total volume of 50 μL ...
-
bioRxiv - Microbiology 2023Quote: ... The library preparation including an enrichment step for 5’-triphosphorylated RNAs by capping the RNAs with 3’-desthiobiotin-TEG-GTP (NEB) [15] and subsequent deep sequencing on a Illumina NextSeq 500 system with 75 bp read length were conducted at Vertis Biotechnologie (Germany ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5 mM each of forward and reverse primers (Supplemental Table 2) and 0.5 U Phusion® HF DNA polymerase (NEB) in a reaction volume of 25 μl ...
-
bioRxiv - Microbiology 2022Quote: ... The purified fragments were then 5’ phosphorylated in a 50 μL reaction containing 10 U of T4 polynucleotide kinase (NEB) and cleaned up through the Monarch PCR & DNA Cleanup spin columns (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA from the indicated cell lines was prepared in agarose plugs by resuspending 5 x 106 cells/ml in 0.8% agarose and digested overnight with Fse1 (NEB; R0588L) at 37 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... while the pML104-PDR1 vector has a guide sequence 5’- CTGGATAAACGTCGCTCCAC-3’ introduced by Q5 polymerase PCR (New England Biolabs) and In-Fusion Snap Assembly (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed three times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (anti-rabbit IgG HRP, 1:5000 dilution, 7074S, NEB) in TBS-T with 1% (w/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3′ RNA adaptor (/5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Systems Biology 2023Quote: ... The glutathione or amylose agarose was then washed 5-10 times to remove unbound proteins before boiling and analysis by SDS-PAGE WB using anti-MBP (NEB) and anti-GST (abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Biochemistry 2023Quote: ... The polyadenylated tail was added by incubation with 5 U of poly-A polymerase (New England Biolabs Inc., Massachusetts, USA) for 30 min at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... the 5’ end of each oligonucleotide to be ligated was phosphorylated using T4 Polynucleotide Kinase (T4PNK) (New England Biolabs: M0201) at 1 U/25 pmol ends incubated at 37 °C for 90 minutes followed by a 65 °C heat shock for 20 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 5-7 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... and the samples were resuspended in cold Nuclei suspension buffer (5 mL PBS, 50 μL NEB BSA (10 mg/mL), and 25 μL RNase inhibitor (40 U/μL)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The digested vector was combined with the amplified inserts in a 5:2 ratio by mass and ligated using a 2X Gibson Assembly Master Mix (NEB) at 50 °C for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... Cells were then spun down at 500 g for 5 minutes and washed with 900 μL of NEBuffer 2.1 (New England Biolabs #B7202). The cells were pelleted (500 g for 5 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... The DNA was digested overnight at 37°C with gentle agitation after adding 25 µl of 10x NEBuffer3 and 5 ul of 25 U/ul MboI (NEB). To biotin end-fill the DNA a 50 ul master mix containing the following was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Biochemistry 2023Quote: Both native and modified oligonucleotides were 5’-32P labeled by [γ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs) following manufactures recommendations ...
-
bioRxiv - Genomics 2023Quote: ... The sRNA 3’ Adaptor (5’/5rApp/ ATCTCGTATGCCGTCTTCTGCTTG /3ddC/) was ligated to the 3’-end of fragmented RNAs using truncated T4 ligase 2 (NEB), and the SRnA 5’ RNA adaptor (5’GUUCAGAGUUCUACAGUCCGACGAUC ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified the library using PCR with a 10 µl reaction mixture containing 5 µl of Phusion High Fidelity MASTER Mix (New England Biolabs), 2 µl of P1 primer (AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC G) ...
-
bioRxiv - Biophysics 2023Quote: Oligonucleotides used as substrates in D-loop assays were radiolabelled at their 5′-end using T4 Polynucleotide Kinase (T4 PNK - NEB) and adenosine triphosphate [γ-32P] (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... media in each well was aspirated and cells were incubated in 80 μL of 1x Hanks’ balanced Salt Solution with 20 mM HEPES and 10 μL 100 μM Coelenterazine-400a diluted in PBS for 5 minutes before adding either 10 μL of 5.5 U of Enterokinase (New England Biolabs #P8070S) in PBS or 10 μL of vehicle PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were harvested and lysed as described above and were run over 5 ml of Amylose affinity resin (New England Biolabs), washed with 100 ml of 20 mM sodium phosphate pH 7.2 ...
-
bioRxiv - Cell Biology 2023Quote: MBP-tagged RH domain was isolated via passing cleared lysate over a gravity amylose resin column containing 5 mL of settled resin (NEB). Column was washed with 150 mL of buffer before eluting protein with wash buffer supplemented with 20 mM maltose ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 μg of library plasmid was digested at 37 °C for 5 hours with NdeI-HF and SacI-HF (New England Biolabs). Subsequently ...