Labshake search
Citations for New England Biolabs :
2051 - 2100 of 6282 citations for 6 Quinolinamine 1 ethyl 1 2 3 4 tetrahydro 2 2 4 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: The following components comprised the RT-LAMP assay: 4 mM of MgSO4 (New England Biolabs), 1× final concentration of the isothermal amplification buffer (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... the following were added into each reaction tube: 0.5 μL of 10x buffer 4 (NEB), 0.5 μL of 1 mg/mLbovine serum albumin solution (NEB) ...
-
bioRxiv - Immunology 2020Quote: The I53-50A and I53-50B.4.PT1 proteins were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Cancer Biology 2021Quote: ... the PCR product was incubated for 4 hours with 2uL DpnI (NEB, Cat. No R0176), at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The second strand was synthesized with 4 U of T7 DNA polymerase (New England BioLabs) and purified with HighPrep PCR beads (MagBio) ...
-
Structure and mechanism of a Type III CRISPR defence DNA nuclease activated by cyclic oligoadenylatebioRxiv - Biochemistry 2019Quote: ... After adding 4 μl 6x DNA loading dye (New England BioLabs, Ipswich, MA, United States), 10 μl sample was analysed by 0.7% native agarose gel electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the fragments were ligated over night at 4°C with T4 DNA Ligase (NEB) and heat shock transformed into DH5α competent E ...
-
bioRxiv - Microbiology 2022Quote: ... PCR master mix reagents (see Figure 4): Taq polymerase and 10X Reaction Buffer (NEB M0273S), nucleotide mix containing 10 mM dTTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250ng of genomic DNA was digested with the 4-base cutter MnlI (NEB, Ipswich, MA), overnight at 37°C according to manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2023Quote: ... Frozen cell pellets were resuspended in 4 mL of IMAC buffer (NEB, Ipswich, MA, USA) on ice and dispersed using an ultrasonic disruptor (Sonics ...
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 ug from each cell line was digested with 25 units EcoRI (New England Biolabs) in 100 ul total volume ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Cell Biology 2023Quote: ... For second strand cDNA synthesis 6 μL of second strand reaction mix was added [1× NEBNext Second Strand Synthesis buffer (NEB #E6111S), NEBNext Second Strand Synthesis Enzyme Mix ...
-
bioRxiv - Genomics 2024Quote: NEB VarSkip amplicon libraries were prepared according to the NEBNext® ARTIC SARS- CoV-2 FS Library Prep Kit Workflow for Illumina® (NEB, Cat No. E7658, Ipswich, MA).
-
bioRxiv - Biochemistry 2021Quote: ... The fragment was ligated into the pLSV101 vector (3:1 molar ratio) with T4 DNA ligase (New England Biolabs) (16 °C overnight) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Microbiology 2021Quote: ... the THN gene was ligated to pICH41021 in a 3:1 molar ratio using T4 Ligase (New England Biolabs) at 4°C overnight and transformed by heat shock into chemically competent E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of the 3’ adapter was done using the T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA, M0204L). Ligation of 5’ adaptor required (i ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ terminus of total RNAs were ligated with the irCLIP adaptor by T4 RNA Ligase 1 (NEB, M0437M). After ligation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 20 minutes at 80 °C followed by adding annealed inserts to vector DNA (0.020 pmol) at a 3:1 molar ratio with T4 DNA ligase (400 units; M0202S, New England Biolabs), T4 DNA ligase buffer and nuclease free water to a final volume of 20 μL for 30 minutes at room temperature and then 65 °C for 10 minutes.
-
bioRxiv - Systems Biology 2020Quote: 3’ ends of the RNA fragments were dephosphorylated using 0.5 U μl−1 calf intestinal phosphatase (New England Biolabs) for 10 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 0,5 μM fluorescently tagged 3’ adapter (MultiplexDX) were ligated with T4 Rnl2(1–249)K227Q (M0351, New England Biolabs) overnight at 4°C and washed three times with PNK/ligation buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 μM fluorescently tagged 3’ adapter (MultiplexDX) were ligated with T4 Rnl2(1–249)K227Q (M0351, New England Biolabs) overnight at 4°C and washed three times with PNK/ligation buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... aurantiaca DW4/3–1 genomic DNA and cut by restriction enzymes NdeI and HindIII (New England Biolabs, Beverly, USA), and ligated into the corresponding sites of the expression vector pET28c(+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mixed in a ratio 1:3 (insert:backbone plasmid) and ligated with T4 ligase according to manufacturer’s instructions (Quick Ligation kit, NEB M2200). The ligation reaction was transformed into competent TOP-10 bacteria and plated on agarose plates with Ampicillin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...