Labshake search
Citations for New England Biolabs :
151 - 200 of 1462 citations for IGFBP2 Human T7 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and T3 (5’-AATTAACCCTCACTAAAGGG-3’) promoter-tagged PCR fragment from each gene using corresponding T7 and T3 RNA polymerase (T3:M0378S; T7:M0251S, BioLabs). Primers used for PCR are listed in Supplemental table 1 ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 72mer Ψ-containing model RNA used for mutation analysis and the 1.8-kb 10% Ψ-modified RNA used for UHPLC-MS/MS were prepared by T7 in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and Pseudo-UTP (Jena Bioscience ...
-
bioRxiv - Immunology 2024Quote: ... pUC57-mini plasmids harboring the WT or mutated coding sequence downstream of T7 promoter were first transcribed into mRNA using the HiScribe T7 ARCA mRNA Kit (New England BioLabs) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription and fluorescent labelling of RNA in vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: In vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Genomics 2023Quote: Constructs encoding either a GFP or an RFP protein were PCR amplified and in-vitro transcribed from a T7 promoter with the HiScribe T7 Kit (NEB), using a mixture of ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 bp Cy3‐UTP labeled RNA was generated using a PCR‐product containing a T7‐promoter site and the HighScribe T7 high yield RNA synthesis kit (NEB) as well as Cy3‐UTP (Jena Bioscience) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200U (4µL) of T7 RNA polymerase (NEB, #M0251S), and 40µM DFHBI to the final volume of 100µL ...
-
bioRxiv - Biophysics 2021Quote: ... We then used T7 RNA polymerase (NEB E2040S) to transcribe sgRNA from this template and purified the sgRNA with RNAClean XP magnetic beads according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... screened using T7 Endonuclease I (New England Biolabs), and confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2019Quote: ... coli T7 Express (New England Biolabs, Ipswich, USA). For small-scale expression and purification of amounts sufficient to analyze protein splicing in cis and trans ...
-
bioRxiv - Cancer Biology 2019Quote: ... T7 endonuclease 1 (New England BioLabs, Cat. # M0302S) was added and incubated at °C for 15 minutes ...
-
bioRxiv - Systems Biology 2020Quote: ... 20 μL T7 DNA ligase reaction buffer (NEB), and 2 μL nuclease-free water then incubating at 37°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... T7 or SP6 RNA polymerases (New England Biolabs). After staining ...
-
bioRxiv - Bioengineering 2021Quote: ... using BbsI cut sites and T7 ligase (NEB). 1×105 MC38 cells were transfected with gRNA-ligated eSpCas9 plasmids for 48 hours using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Bioengineering 2020Quote: ... 5U/μl T7 RNA polymerase (New England Biolabs), 1U/μl SUPERase In (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... 5U/μl T7 RNA polymerase (New England Biolabs), 1U/μl SUPERase In (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... T7 Express LysY competent cells from NEB (C3010I) were transformed with plasmid pEcoli-Cov_42 (Supplementary Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... coli T7 Express competent cells (Dcm-, NEB #C2566) and plated on agar plates with ampicillin selection (100 μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... T7 exonuclease (0.3 U/µL, New England Biolabs) was mixed with the purified dsDNA (60 ng/µL ...
-
bioRxiv - Biochemistry 2022Quote: ... in T7 Express cells (New England BioLabs, MA). Cells were grown at 37°C to OD600 of 0.8 at which time 0.5 mM Isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... and T7 DNA Ligase (M0318, New England Biolabs) by PCR ...
-
bioRxiv - Microbiology 2020Quote: ... coli BL21 T7 Express lacIq (New England Biolabs) from the pLIC-trPC-HMA plasmid with an N-terminal hexahistidine-maltose binding protein (HisMBP ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 T7 Express cells (New England Biolabs). Fresh transformants were grown in Terrific Broth (TB ...
-
bioRxiv - Developmental Biology 2020Quote: ... T7 or SP6 RNA polymerases (New England Biolabs). After staining ...
-
bioRxiv - Molecular Biology 2020Quote: ... and T7 endonuclease I (M0302S, New England Biolabs).
-
bioRxiv - Biochemistry 2021Quote: ... one colony of T7 Express competent cells (NEB), transformed with a pET-15b plasmid for the expression of microID ...
-
bioRxiv - Genetics 2021Quote: ... An 80 uL T7 ligation reaction (NEB, M0318S) containing 200 ng of digested plasmid and 37.7 ng of library was performed followed by cleanup and electroporation into DH5α electrocompetent cells (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... T7 SHuffle (C3026, E. coli K strain, NEB) and Nico (λDE3 ...
-
bioRxiv - Microbiology 2021Quote: ... T7 Express with LysY and lacIq (C3013, NEB), T7 SHuffle (C3026 ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U/μL T7 RNA polymerase (NEB, M0251L), 1 U/μL RNase inhibitor (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and then 2 μl of T7 Endonuclease (NEB) was added ...
-
bioRxiv - Developmental Biology 2023Quote: ... transcribed with T7 polymerase (E2040S, New England Biolabs) and purified using mirVana miRNA isolation kit (AM1560 ...
-
bioRxiv - Molecular Biology 2023Quote: ... HiScribe T7 High Yield RNA Synthesis Kit (NEB) was used for in vitro transcription ...
-
bioRxiv - Cancer Biology 2023Quote: ... coli strain T7 Express Iq (NEB, Cat. # C2833H) was optimized to yield ∼100 mg/L of recombinant ORF1p-His6 (346 aa ...
-
bioRxiv - Biochemistry 2023Quote: ... coli ER2566 cells (New England Biolabs T7 Express) harboring the pFCEX1D plasmid (containing wild-type FsC ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1:300 T7 RNA polymerase mix (NEB) in transcription buffer (30 mM Tris pH 7.5 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli T7 Express lysY (New England Biolabs, UK) from pET28a/Cas9-Cys (Addgene plasmid # 53261) ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR product using T7 RNA polymerase (NEB, M0251L) as described previously 18 ...
-
bioRxiv - Microbiology 2024Quote: ... restriction enzymes and T7 ligase (NEB Biolabs, USA) were used according to manual ...
-
bioRxiv - Microbiology 2024Quote: ... restriction enzymes and T7 ligase (NEB Biolabs, USA) were used according to manual ...
-
bioRxiv - Genomics 2020Quote: ... Purified dsDNA templates were used as templates for T7 transcription reactions using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and bio-16-CTP (Trilink ...
-
bioRxiv - Immunology 2019Quote: IVT was performed using the T7 promoter of the pcDNA3.3_NDG plasmid and HiScribe T7 ARCA mRNA kit with tailing (NEB #E2060S, Ipswich, MA). Whole kit was used with 20 ug DNA following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: mRNA synthesis via in vitro transcription was performed using linearized plasmid DNA using High Scribe T7 Polymerase HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs): 100 mM NTPs ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2021Quote: ... 10 ul of this was then used as an input for T7 polymerase mediated In vitro Transcription (IVT) using the NEB HiScribe T7 High Yield RNA Synthesis Kit (NEB, # E2040S). Briefly ...