Labshake search
Citations for New England Biolabs :
1601 - 1650 of 4857 citations for 5 3 Chloro 4 2 cyclohexylethoxy phenyl methylene 2 4 thiazolidinedione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Donor sequences were then inserted at the HindIII (5’) and XhoI or BamHI at (3’) sites using HindIII-HF and XhoI-HF or BamHI-HF (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... then the reactions were made to a total volume of 80 µL containing 1 equivalent of GlycoBuffer2 and 3–5 µL of Remove-iT PNGase F (P0706, NEB), incubated at 37°C for 2 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... The array DNA was composed of a fluorescent nucleotide Alexa Fluor 647-aha-dCTP (ThermoScientific) and was generated using Klenow Fragment 3’ – 5’ exo- (NEB). Nucleosome arrays were mixed with SUV420H1 or 5μM HP1α and incubated at room temperature for 20 mins before transferring to a glass bottom 384 well plate for imaging ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a synthetic 391 bp double-stranded DNA fragment encoding 5′-(1st gRNA/scaffold/H1 promoter/2nd gRNA)-3′ was inserted using the NEBuilder HiFi assembly system (NEB). Synthetic DNA fragments were ordered from Genewiz and sequences are listed in Table S6 ...
-
bioRxiv - Bioengineering 2023Quote: ... The error-prone PCR (with an error rate of 3- to 5-nucleotide mutations per kilobase) was carried out with the Taq DNA polymerase (New England BioLabs) in a reaction containing 2 µl of 10 mM primers ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the radiolabeled 3’ fragment was ligated to an unlabeled 5’ fragment by splinted ligation with T4 DNA ligase (NEB) at 30°C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... and nCoV_IP4-14084 Probe(+)TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as PFU equivalents (eqPFU ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biochemistry 2024Quote: ... either at the 5’ or 3’ of the trimerization domain and then inserted into a pET29b+ vector using PaqCI (NEB). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Cell debris was removed by centrifugation at 15,000 x g for 30 min at 4°C and the clarified extract was loaded onto a chitin resin (NEB) column pre-equilibrated with column buffer for purification at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20 μl of each clean digestion product were split equally in two 0.2 ml PCR tubes (15 μl in each) and 4 μl of Adaptor ligation buffer (5x T4 DNA Ligase Buffer (New England Biolabs) and 10 μM of the dsAdR adaptor along with 1 μl (400 U ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Nanopore library was prepared using Oxford Nanopore Technologies ligation sequencing kit (SQK-LSK108) from 4 μg of T7 endonuclease I (New England Biolabs) treated WGA ...
-
bioRxiv - Genomics 2020Quote: ... sticky-ended DNA was incubated in 1x T4 DNA ligase buffer with 4 μl (400 U/μl) of T4 DNA Ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... branched DNA (which can be a consequence of the RCA) was resolved by a 1 hour incubation at 37°C with 4 μl T7 endonuclease (New England Biolabs) and re-purified using AMPure beads ...
-
bioRxiv - Biophysics 2021Quote: ... The unbound MBP or 4 MBP that remained in the unbound fraction was then loaded on Amylose resin (New England Biolabs) previously equilibrated in buffer D ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences corresponding to the constructs shown in Figure 4 were purchased as gBlocks from IDT and cloned using Gibson cloning (NEB) into the BamHI site of the pYDL reporter ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was ligated by incubation at 16°C for 5h in 4 ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the ligation of the custom sequence adapters was done in solution by adding 4 μl adaptors (30 μM) and 1600 units T4 DNA ligase (NEB). The ligation was carried at for 2 hours at room temperature on a rotating wheel in 1x ligation buffer (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... excess salts and enzymes were removed by centrifugation (600 g for 5 minutes at 4°C) and the cell pellet was re-suspended in 995 μl of 1 x ligation buffer (NEB) supplemented with BSA (100 μg/mL final concentration) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’ UTR of Pir121 was PCR amplified from genomic DNA using the primers listed in Table S2 and cloned into pPT808 [4] using Gibson assembly (NEB). All plasmids used in this study are listed in Table S3.
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed 4 PCRs per pool from cDNA and gDNA respectively using the Q5 High Fidelity 2X Master Mix (New England Biolabs), then pooled the PCRs and purified them ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The vector and the PCR insert were used to prepare 4 ligation reactions by mixing with T4 Ligase (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... cholerae H-NS protein was purified as previously described (4) using the IMPACT-kit (New England Biolabs, Catalogue No. #E6901S). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... the SYLF domain was mutagenized by ordering a synthetic DNA sequence carrying point mutations (Table 4) and replaced by restriction enzyme digestion with NcoI (NEB) and XbaI (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation began with the digestion of 1pg–200 ng genomic DNA in a 15-µl reaction using 4 U BcgI (NEB) at 37 °C for 3 h ...
-
bioRxiv - Systems Biology 2022Quote: Expression vectors (SCRIPT 1-4; Supplemental Figure S1) were constructed by a Golden Gate reaction with BsaI (New England Biolabs) using the paired gRNA entry vectors and a destination vector as previously described (Decaestecker et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... at 95°C for 5 min and incubated with 80000 units of O-glycosidase and 100 units of neuraminidases for 4 hours at 37°C following the NEB kit protocol (E0540S; NEB). Samples were resolved on 15% Tris-tricine SDS-PAGE gel and blotted using anti-Cterm OCN goat antibody.
-
bioRxiv - Biochemistry 2021Quote: ... Each reaction was 400 µL total (split into 4 x 100-µL aliquots) and contained 1X Q5 reaction buffer (New England BioLabs), 200 µM dNTPs ...
-
bioRxiv - Biochemistry 2020Quote: ... eluted protein samples may be treated with TEV protease at 4 °C overnight before flowing through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Microbiology 2020Quote: ... was linearized in a 500 μL reaction volume containing 100 units of ApaLI enzyme for 4-6 hours at 37°C in CutSmart buffer (New England Biolabs). The DNA was then ethanol precipitated as previously described (76) ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Cancer Biology 2022Quote: ... The new SNAP-tagged histones synthesized during the chase were fluorescently labelled with 4 μM of the green-fluorescent reagent SNAP-cell Oregon green (New England Biolabs) during a 15-min pulse step followed by 30-min wash in fresh medium ...
-
bioRxiv - Genomics 2022Quote: ... Two 500 ng reaction tubes of DLE1-labeled DNA were each mixed with 4 μL of 10X CutSmart buffer (New England Biolabs), 60 μM of lab-made synthetic AdoYnATTO643 (see synthesis in the Supplementary Data) ...
-
bioRxiv - Genetics 2022Quote: NGS libraries were generated by amplifying 12 μl of the eluted CUT&Tag DNA fragments with i5 and i7 barcoded HPLC-grade primers (90) (Suppl. Table 4) with NEBNextHiFi 2x PCR Master Mix (New England BioLabs) on a thermocycler with the following program ...
-
bioRxiv - Genetics 2022Quote: ... or three (for cloning 4 sgRNAs) fragments were ligated in an equimolar ratio in a Golden Gate reaction with T4 ligase (New England Biolabs) and the BsmBI isoschizomer Esp3I (New England Biolabs ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Molecular Biology 2023Quote: ... increasing volumes of SPRI beads were mixed with 1 μl of a 4-fold dilution of 100 bp DNA ladder (New England Biolabs) and diluted to a final volume of 100 μl with 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Neuroscience 2022Quote: 4 µl procainamide-labeled glycans were combined with 1 µl 10x sodium acetate – Ca2+ buffer (Glycobuffer 1, New England Biolabs), 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock ...
-
bioRxiv - Neuroscience 2024Quote: ... a 92-repeat sequence was isolated from a previously verified in-house construct with NheI and NotI restriction digests and subcloned into the MCS of pCDH-EF1-C9up-MCS-C9down-IRES-copGFP with overnight ligation at 4°C (T4 ligase, NEB). To maintain repeat stability ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples then underwent two separate digestion reactions (with up to 4 µg of genomic DNA) using NlaIII and MseI enzymes (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 30 min and then at 60 V (∼4 V/cm) until the pink loading dye was reached in 6x gel loading dye (B7025S, New England Biolabs), which shows a similar migration speed to that of bromophenol blue ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Bioengineering 2024Quote: ... pH = 8 for 16 hours at 56°C followed by 30 minutes at 90°C and an additional digest of 4 units of beta-agarase (M0392S, New England BioLabs) for 1 hour at 65°C to ensure full agarose breakdown ...