Labshake search
Citations for New England Biolabs :
1601 - 1650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Escherichia coli strains used in this study were NEB 10-beta competent cells (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli Poly(A) Polymerase (NEB, M0276L), cleaned up using P30 column and phenol chloroform extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg of PCR product was used in an in vitro transcription reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB, E2040S) in the presence of 20units/mL SUPERaseIn ...
-
bioRxiv - Molecular Biology 2024Quote: ... was added to 500 ng total RNA then the rRNA was depleted with the NEBNext rRNA depletion kit V2 (NEB, E7400L) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Neuroscience 2024Quote: Libraries for sequencing were prepared using the NEBNext Ultra II library prep kit (New England Biolabs) following the protocol and thermocycling temperatures therein ...
-
bioRxiv - Microbiology 2024Quote: ... they were purified using Monarch DNA Gel Extraction kit (New England Biolabs) and assembled by two-step PCR (supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA from 12 of the clones was extracted and mutations were verified by PCR using OneTaq polymerase (New England Biolabs) with the appropriate primers (supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... and assembled by two-step PCR (supplementary methods) using Q5 polymerase (New England Biolabs). First ...
-
bioRxiv - Microbiology 2024Quote: ... The DNA fragment carrying the cassette was obtained by overlap PCR using Q5 polymerase (New England Biolabs). For each target gene ...
-
bioRxiv - Microbiology 2024Quote: ... The two PCR products were extracted and assembled using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The assembly product was transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... coli DH5-α (New England Biolabs), plated on LB agar plates in the presence of 50 μg/ml kanamycin ...
-
bioRxiv - Microbiology 2024Quote: ... The coverslips are then incubated for 30 min at 37°C with DMEM supplemented with 10% SVF containing 0.12 μM SNAP-Cell TMR-Star (New England Biolabs #S9105S), rinsed twice with PBS and incubated for 45 min with Dapi (1μg/ml) ...
-
bioRxiv - Microbiology 2024Quote: ... The membrane was incubated for 1 hour in the presence of an anti-SNAP-tag primary antibody (New England Biolabs #P9310S) diluted at 1:2000 in PBS + tween-20 0.1% ...
-
bioRxiv - Microbiology 2024Quote: ... Two µl of SNAP-Cell Block (New England Biolabs #S9106S) were added to strain 2C4.3 WT ...
-
bioRxiv - Microbiology 2024Quote: ... the SNAP tag (New England Biolabs #N9183S) was inserted after the Ptet or Plac promoter with the appropriate primers (supplementary methods) ...
-
bioRxiv - Microbiology 2024Quote: Plasmids DNA were extracted (Monarch Plasmid Miniprep, New England Biolabs) and sequenced by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Microbiology 2024Quote: ... was cloned into plasmid pHR-SFFV-ZF3-P2A-BFP using Gibson assembly (New England Biolabs Cat#E2611S) by substituting the KRAB region in between the ZFP3 and P2A region.
-
bioRxiv - Microbiology 2024Quote: ... The vector backbone and insert fragments were amplified with Q5 high-fidelity DNA polymerase (M0491L, NEB) and ligated together with the ClonExpress® Ultra One Step Cloning Kit (C112-02 ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Microbiology 2024Quote: ... 6 U DNase-I (NEB) and 3 µL RNase A (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Each gene was PCR amplified from the plasmids using Q5 polymerase (New England Biolabs; NEB) with the primers 5’-GAAGTGCCATTCCGCCTGACC and 5’-CACTGAGCCTCCACCTAGCC ...
-
bioRxiv - Neuroscience 2024Quote: ... and effectors were cloned using the Gibson Cloning Assembly Kit (New England BioLabs, catalog no. NEB-E5510S). After cloning and sequencing ...
-
bioRxiv - Cancer Biology 2024Quote: ... Q5 High-Fidelity 2x Master Mix (M0494X, New England Biolabs) was used to amplify the U6-BC-crRNA region from 32 μg of genomic DNA in a total reaction volume of 800 μl per sample using unique dual-indexed primers as described22 ...
-
bioRxiv - Pathology 2024Quote: ... The resulting eluent was further purified with amylose resin (New England BioLabs E8021S) which binds MBP and then washed with amylose wash buffer (50 mM HEPES ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was digested with RNase H (NEB) and RNase A/T1 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... RRID:Addgene_119754).CAPS-GST protein was expressed in BL21Star bacteria (NEB); the protein was isolated by binding to glutathione-Sepharose (Pierce ...
-
bioRxiv - Genetics 2024Quote: ... with oligo-dT20 and RNase H (New England Biolabs Massachusetts, USA). The full length of the alleles of both genes were then amplified from the cDNA using Phusion Taq polymerase under the following conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... Oligo design, annealing and synthesis were performed as previously described (Bai et al., 2022) using BsaI-HF®v2 (NEB) digested vector pKS diaCas9_sgRNA (Addgene #74923) ...
-
bioRxiv - Plant Biology 2024Quote: ... PCR reactions were run on 1.2% TAE agarose gel with a standard 1kb ladder (New England BioLabs) to confirm formation of products ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were generated using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs, #E7645L) according to the manufacturer’s instructions and PCR amplified ...
-
bioRxiv - Neuroscience 2024Quote: ... then linearised with NheI-HF (New England Biolabs) and purified using QIAquick PCR Purification Kit (QIAGEN) ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were prepared using NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, #7490) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... and Lambda Exonuclease (all NEB) was carried out for 16 hours at 37C then heat inactivated for 20 minutes at 80C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analysed on an Illumina instrument by following manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2024Quote: ... and ligation to adapters with “NEBNext Ultra II DNA Library Prep Kit for Illumina” (NEB #E7645). Adapter-ligated libraries were completed by a PCR of 21 cycles of amplification ...
-
bioRxiv - Developmental Biology 2024Quote: ... Whole cells were processed with the “NEBNext Single Cell/Low Input RNA Library Prep” kit (NEB #E6420) by following manufacturer instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x 10 µl Phusion® High Fidelity PCR master Mix with HF buffer (Biolabs new England M0531S). The thermocycler program was 94 °C for 30 sec ...
-
bioRxiv - Plant Biology 2024Quote: ... ble cassette and 1 kb 3’ homologous arm onto the BamHI (NEB) digested backbone of pUC57 ...
-
bioRxiv - Plant Biology 2024Quote: ... Phusion® HF DNA polymerase (NEB, USA) mediated PCR amplification of the ZEP3 gene included all exon ...
-
bioRxiv - Pathology 2024Quote: ... the NEBNext Ultra RNA Library Prep Kit for Illumina (E7530L, NEB) was utilized ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Endo Hf (Cat.#P0703S; New England Biolabs) or PNGase F (Cat.#P0708L ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 20 µL of denatured protein lysate was combined with 2.5 µL of 10X GlycoBuffer 3 (Cat.#B1720S; New England Biolabs) and 2.5 µL of Endo Hf in a total reaction volume of 25 µL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1.1 µL of HindIII-HF (Cat.#R3104S; New England Biolabs) diluted with CutSmart® Buffer (Cat.#B7204S ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... diluted with CutSmart® Buffer (Cat.#B7204S; New England Biolabs), 7.7 µL (50 ng ...
-
bioRxiv - Pathology 2024Quote: ... and Luna® Universal qPCR Master Mix (M3003E, New England BioLabs) on a LightCycler 480 II (Roche Diagnostics ...
-
bioRxiv - Genetics 2024Quote: ... Then 6.25nM of 5mC sequencing adapter (NEB E7535S) was ligated with 1 μl T4 DNA Ligase ...
-
bioRxiv - Genetics 2024Quote: ... Cells were then pelleted by centrifugation at 500 x g for 10 min and washed with 200 µL of 1.5X DpnII reaction buffer (New England Biolabs Ipswich, MA cat no. R0543S), pelleted again and then resuspended in 300 µl of cold 1.5X DpnII reaction buffer (NEB cat no ...
-
bioRxiv - Genetics 2024Quote: ... 120 μL (4 mg/mL) streptavidin magnetic beads (NEB cat no. 50-812-660) were washed 3 times with 1 mL of lysis buffer then resuspended in 100 μL of complete lysis buffer and added to the hybridization mix and then incubated at 37 °C for an additional 30 min with mixing ...
-
bioRxiv - Genetics 2024Quote: ... Plasmid was then digested with EcoRI and EcoRV (NEB) overnight to generate linear chromatin templates (i.e. ...