Labshake search
Citations for New England Biolabs :
1401 - 1450 of 4797 citations for 8H INDENO 1 2 D THIAZOL 2 AMINE HYDROBROMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA; Fig. 2). Size selection was not employed for samples with highly degraded DNA ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Amplified guide RNAs were cloned in a 100 μl assembly reaction with 1.0 μg linearized pNTI661 and 1.7 μl guide RNA PCR using 2 × NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L), which was incubated for 1 hour at 50 °C and then purified with a DNA Clean & Concentrator with final elution into 10 ...
-
bioRxiv - Cancer Biology 2021Quote: ... samples were mixed with 7 μl 5x Ultra II FS buffer and 2 μl Ultra II FS enzyme (New England BioLabs), and incubated 12 minutes at 37 °C followed by 30 minutes at 65 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... F0 founders were identified by outcrossing TALEN or CRISPR/Cas9-injected fish with wildtype fish and screening the offspring for mutations at 2 dpf using T7 endonuclease I (NEB) assay (for TALEN-injected fish ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL from both ssDNA and reverse-transcribed RNA samples were used to template PCR amplification using Taq polymerase (NEB). The resulting amplicons were treated with either ClaI or DraI (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM of purified protein was combined with 2 mM DTT and 10 mM SNAP-Surface Alexa Fluor 546 (New England Biolabs) in PBS for 60 min at 30°C ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein expression was induced with 0.3 mM IPTG for 2 hours at 37°C and recombinant MBP-rabaptin5 was purified with an amylose resin (New England Biolabs) according to manufacturs instructions and dialysed against lysis buffer (20 mM Tris-HCl ph7.4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR product was either separated on a 2% agarose gel for 3 hours or digested overnight with MwoI (New England Biolabs) and separated on an agarose gel to determine individual fish genotypes ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were generated with the primers listed in Supplementary Table 2 using HF Phusion DNA polymerase (New England Biolabs).
-
bioRxiv - Genomics 2019Quote: ... The library was prepared using the NEBNext Ultra II kit and indexes from the Dual Index Primers Set 2 (all New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation mixture was then used in a PCR reaction with primers 2569/2570 (Table 2) and Phusion DNA polymerase (New England BioLabs). PCR was carried out in 50 μl reactions for 3 min at 98°C followed by 30 cycles of 1 min at 98°C ...
-
bioRxiv - Microbiology 2020Quote: High throughput sequencing libraries were prepared using RNA isolated from total RNA or PAR-CLIP samples using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 2; cat# E7580, New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... A 2-micron Ura3-selective plasmid was constructed from three DNA fragments using HiFi DNA Assembly Master Mix (New England Biolabs) for cloning ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each PCR amplification product was digested overnight at 37 °C with 2 μl of CutSmart® uffer (New England Biolabs) and 0.2 μl of AccI enzyme (10 U/mL ...
-
bioRxiv - Bioengineering 2021Quote: ... was carried out (25 ng linearized vector, 10 ng purified insert, 10 µL 2 x Gibson Assembly Master Mix (New England BioLabs) and up to 20 µL H2O were mixed and incubated at 50°C for 1 hour) ...
-
bioRxiv - Cell Biology 2021Quote: ... using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers) and cloned by Gibson Assembly Cloning Kit (EE5510S, NEB). All primers were designed using SnapGene (GSL Biotech LLC ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction tube of 20 µl contained 10 µl of Q5 High-Fidelity 2× Master Mix (New England BioLabs Inc.), 20 pmol of forward and reverse primer ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Microbiology 2022Quote: ... 4.5 μg of RCA material was diluted in 65 μL of nuclease-free water and treated with 2 μL of T7 endonuclease I (New England Biolabs) for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins from the supernatant at 2 mg/mL were used for the Co-IP assay using Protein G magnetic beads (New England Biolabs) and a mouse monoclonal anti-HA antibody (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was done with 1-2 ng of plasmid and 200 nM of each primer in Phusion High-Fidelity PCR Master Mix (New England Biolabs) with pre-denaturation at 98°C for 5 sec followed by 12 cycles of 98°C for 5 sec ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μl of the Phire PCR reaction was verified on a 2% agarose gel with a low molecular weight ladder (N3233S, NEB). 15 μl of PCR products were pooled and purified using PCR Purification Kit (D4013 ...
-
bioRxiv - Microbiology 2022Quote: ... Boiled tRNA was mixed with 12 μL PEG buffer mix (10 μL 50% PEG8000, 2 μL 10 × buffer B0216S; New England Biolabs). 3 μL of 5’ adenylated linkers (Table S3 ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries were size selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... multiplex qPCR was performed on a Bio-Rad C1000 Touch Thermal Cycler using Hot Start Taq 2× Master Mix (NEB) with HT_Forward and HT_Reverse primers (IDT ...
-
bioRxiv - Microbiology 2022Quote: ... Presence of SARS-CoV-2 RNA was determined by using CDC primers and probes with LunaScript RT Supermix Kit (NEB) run on BioRad (Hercules ...
-
bioRxiv - Molecular Biology 2022Quote: ... The end-repaired cDNA was ligated with 2 μL barcoded adaptor (100-466-000, Pacific Biosciences) with T4 DNA Ligase (M0202, New England Biolabs) in 50 μL reaction volume at room temperature for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... and a double HA tagged NanoLuc to the genomic locus was reintroduced into MluI linearized pCRIS-PITChv2 vectro backbone with NEBuilder 2× HiFi assembly (New England Biolabs)51.
-
bioRxiv - Molecular Biology 2022Quote: ... This PCR product was then introduced in MluI linearized pCRIS-PITChv2 vector via NEBuilder 2× HiFi assembly (New England Biolabs). Primers containing 20 to 22 bp homology regions corresponding to the genomic locus 5’ and 3’ of the sgRNA cleavage were used to PCR this cassette ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Biophysics 2024Quote: ... cDNA (2 μl) was used as template in 50 μl PCR reaction with Phusion Hot start flex (New England Biolabs). Reaction conditions ...
-
bioRxiv - Plant Biology 2024Quote: ... with 2 µg of the freshly synthetized SgRNA1 obtained with the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). DNA repair templates containing the fenhexamid resistance cassette surrounded by 60 bp of the target gene for HR were obtained by PCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...
-
bioRxiv - Immunology 2023Quote: ... Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS: E6440S, NEB). After demultiplexing these samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... Four PCR fragments of around 2,700 nucleotides long were generated from cDNA using primer pairs (Suppl. Table S2) with NEB Q5 Hot-Start high-fidelity 2× Master Mix (New England Biolabs). Fragments were gel-purified with MinElute gel extraction Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Pathology 2023Quote: Total RNA extracted from hearts of Ctrl and Eprs1cKO-homoat 2 weeks post tamoxifen injection were treated with DNase I (NEB) to remove potential genomic DNA in the RNA samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2) library for miRNAs detection utilizing NEBNext® Small RNA Library Prep Set for Illumina (New England Biolabs (UK) Ltd ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were then size selected for cDNA target fragments of 200–300 bp on 2% Low Range Ultra Agarose followed by PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles ...