Labshake search
Citations for New England Biolabs :
1301 - 1350 of 2065 citations for P N Nonylphenol Diethoxylate Ring 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... was incubated with 0.025 U of Nt.BbvC1 in a final volume of 100 µl of 1 X CutSmart buffer (New England Biolabs) to introduce sequence specific nicks in λDNA ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Plant Biology 2021Quote: ... Digested DNA was ligated during 5 h incubation at 16 °C with 100 U of T4 DNA ligase (NEB). DNA was recovered after reverse crosslinking and Proteinase K treatment (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... beads were pelleted and resuspended in 100 μl of phosphatase buffer with lambda protein phosphatase (P0753; New England Biolabs) before agitation at 30°C for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... 100 ng of genomic DNA were digested for 6h at 65°C with 20 U TaqI (New England Biolabs) and 6h hours at 37°C with 20 U of MspI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... In vitro SpCas9 and Cas12 cleavage reactions were performed in 100 µL reactions with 1X Cas9 Reaction Buffer or NEBuffer 3.1 (NEB) for Cas9 or 1x NEBuffer 2.1 (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... EvaGreen DNA dye was replaced with RPA fluorescent probes (DENV2-CAP-probe at 0.12 μM) with 100 U Exonuclease III (NEB), keeping all other reagents same ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was cut into pieces and PK buffer (100 mM Tris pH 7.4, 50 mM NaCl, 10 mM EDTA) was added together with Proteinase K (NEB). After 90 min of incubation at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2mM Vanadylribonucleoside complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Microbiology 2020Quote: ... Annealed adapters were ligated onto DNA by resuspending the beads in a 100 μL reaction containing Quick Ligase (NEB) and 0.1 μM annealed i5/i7 adapter ...
-
bioRxiv - Genomics 2022Quote: ... 10 μL 6% Tritоn X-100 were used for SDS quenching and chromatin fragmentation was performed with 25U DpnII (New England Biolabs) at 37°C for overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... each well containing 0.8 µL Primer Master Mix (0.225% Triton X-100, 1.6 mM dNTP mix, 1.875 uM barcoded oligo[dT] CEL-seq2 primers; Sigma-Aldrich, New England Biolabs) using a BioSorter (Union BioMetrica ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were collected by centrifuging and resuspended with 100 µL of 0.3% SDS in 1×NEBuffer 2.1(NEB, B7002S) with following shaking at 37°C for 30 minutes at 900 rpm ...
-
bioRxiv - Genetics 2020Quote: 300 intestinal stem and Paneth cells were sorted into 2 μl of nuclease free water with 0.2% Triton-X 100 and 4 U murine RNase Inhibitor (NEB). RNA was reverse transcribed (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and permeabilized for 5 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Ribonucleoside Vanadyl complex (New England Biolabs). Coverslips were preserved in 70% EtOH at −20 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatant was removed and the pellet was resuspended in 100 µl of ice cold PBS + 0.04% BSA (NEB B9000S). 40µm FlowMi cell strainers were pre-wetted with ice cold 200µl of PBS and the resuspended nuclei were gently filtered through the FlowMi into 1.5mL Eppendorf tubes ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
bioRxiv - Genomics 2021Quote: RNA-seq libraries were constructed using 100 ng of total RNA and NEBNext Ultra II RNA Lib Prep (NEB, Ipswich ...
-
bioRxiv - Genetics 2021Quote: ... Cells were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in −20°C in 70% EtOH until further use.
-
bioRxiv - Plant Biology 2021Quote: ... The RNP was incubated with the purified target DNA (100–200 ng) in CutSmart® buffer (New England BioLabs) in a total volume of 10 μL ...
-
bioRxiv - Biochemistry 2021Quote: ... The dried pellet was resuspended in 20 μl TE supplemented with 0.1 mg ml-1 RNase A and incubated for 2 hours at room temperature before being run on a 1.0 % TAE gel together with a 100 bp ladder (NEB) for ∼90 min at 100 V ...
-
bioRxiv - Developmental Biology 2021Quote: ... Chromatin was digested with 100 U of MboI restriction enzyme (90 min at 37C with rotation; New England Biolabs) and the enzyme was heat-inactivated at 62C for 20 min ...
-
bioRxiv - Systems Biology 2021Quote: ... 3 μL of the reverse phasing primer pool (100 nM) and 15 μL of Q5 Mastermix (New England Biolabs). Cycle conditions were 4 minutes at 98°C followed by 20x (30 seconds at 98°C ...
-
bioRxiv - Microbiology 2021Quote: ... 100 mM NaCl and 0.2% Tween 20 and resuspended in 50 μL of 1X blue loading buffer (NEB, B7703S) and heated for 10 min at 96°C.
-
bioRxiv - Molecular Biology 2021Quote: ... Oligonucleotide pairs were phosphorylated and annealed by mixing 100 pmol of each pair and 0.5 μL T4 PNK (NEB) then incubated at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2022Quote: ... a total of 100 ng of SED vector construct was digested with 5 U of I-SceI meganuclease (NEB) at 37°C for 10 minutes in a 10 μL reaction mixture ...
-
bioRxiv - Genomics 2022Quote: ... The marker well is filled with 20 µL of a 1:40 dilution of 100 bp ladder (NEB N3231L). The gel is run on an E-Gel Power Snap Electrophoresis Device (ThermoFisher G8100 ...
-
bioRxiv - Genetics 2022Quote: ... Embryos were fixed in 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 4 min on ice in PBS containing 0.5% Triton X-100 and 2 mM Vanadyl-ribonucleoside complex (New England Biolabs). Coverslips were stored in 70% EtOH in −20°C no longer than 1 day before further processing.
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was sheared by incubating the nuclei in 100 µl of buffer B supplemented with 1,000 units of micrococcal nuclease (M0247S; NEB) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forward and reverse primers (100 µM) were phosphorylated and annealed using T4 Polynucleotide Kinase (PNK; New England Biolabs M0201S) and 10x T4 Ligation Buffer (Thermo B69) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The second strand synthesis was then performed by adding 100 μl Q5 Hot Start High Fidelity Master Mix (NEB), 10 μl RNase H (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized with ice-cold permeabilization buffer (1X-PBS, 0.5% Triton X-100, 2 mM vanadyl-ribonucleoside complex (New England Biolabs)) for 4 min on ice ...
-
bioRxiv - Immunology 2024Quote: ... top and bottom strand oligos (1 µl of 100 µM each) were phosphorylated with T4 PNK (New England Biolabs) for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: Final PCRs on cDNAs were performed in a 100 µL scale using 2.0 µL precipitated cDNA in the presence of 1 x High-Fidelity PCR MasterMix (NEB), 2 µM forward primer with native barcode and 2 µM reverse primer with native barcode (e.g BC1 fwd and rev ...
-
bioRxiv - Biochemistry 2023Quote: ... in a total reaction volume of 100 µL consisting of 50 units of T4 RNA ligase 1 (NEB #M0204S), 1mM ATP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligation reaction was performed with 100 ng of digested vector backbone and 70.8 ng of inserts using T4 DNA ligase (NEB) at 16°C for 15 hours.
-
bioRxiv - Genomics 2023Quote: ... each were incubated in parallel with 100 U or 0 U of M.CviPI (Xu et al. 1998) (New England Biolabs) in methylation buffer (320 µM S-adenosyl-L-methionine in CRB ...
-
bioRxiv - Genomics 2023Quote: ... or 100 cGy) was processed for bisulfite sequencing library construction using NEBNext Ultra II DNA Library Prep Kit (NEB) along with methylated and indexed NEXTflex Bisulfite-seq Barcodes (Bio scientific) ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplicons for long-range sequencing were generated with Q5 High-Fidelity polymerase in 100 uL reactions (New England Biolabs) including500 nM primers and up to 1000 ng genomic DNA using the following PCR protocol ...
-
bioRxiv - Biophysics 2023Quote: ... was supplied in a final concentration of 2.04ng/μL (for each rung) and the 100-1000bp ladder (100bp DNA Ladder, New England BioLabs) in a final concentration of 71.4ng/μL (for all rungs ...
-
bioRxiv - Cancer Biology 2023Quote: ... the poly(A)+ RNA was sheared into 100–200-nt fragments using Magnesium RNA Frag mentation Module (NEB, E6150S). A portion of poly(A)+ RNA fragment was directly used as input ...
-
bioRxiv - Molecular Biology 2023Quote: ... 37°C with rotation) in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... The extracted chromatin was digested for 3 hours at 37 °C in a volume of 250.0 μL with 100 U of NlaIII (NEB) for 3C library preparation ...
-
bioRxiv - Physiology 2023Quote: ... and the sizes of PCR products were calibrated using a 100-bp DNA Ladder (New England BioLabs, Ipswich, MA). Mice were genotyped using the following primer pairs ...
-
bioRxiv - Bioengineering 2023Quote: ... 100 ng of the extracted gDNA were for PCR with the Q5 high-fidelity DNA polymerase (New England Biolabs). The product was analyzed via gel electrophoresis ...
-
bioRxiv - Genetics 2023Quote: ... 100 ng of genomic DNA was digested with 5U of BtsCI in a 3 μl reaction (New England Biolabs), 1 hour at 50°C incubation and no enzyme denaturation ...
-
bioRxiv - Biochemistry 2023Quote: Approximately 100 µg of extracted protein was incubated with 2 µL (1,000 U) of PNGase F (New England Biolabs) at 37°C for 48 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... in buffer 3 (100 mM NaCl, 50 mM Tris-HCl, pH 7.9, 10 mM MgCl2, and 1 mM DTT, New England Biolabs) or in 50 mM NaCl ...