Labshake search
Citations for New England Biolabs :
1101 - 1150 of 3791 citations for Recombinant Human Aldehyde Dehydrogenase 1 Family Member A3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Blocking was achieved using 1% BSA (NEB) and 0.1% Tween-20 in 1× PBS for 1 h at room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 1 µl Exo-CIP Tube B (NEB) were mixed and incubated at 37°C for 4 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... and T4 ligase (30 U.μL-1, NEB) and incubated at 25°C for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1× RNaseH Reaction Buffer (NEB Japan) at 37 ℃ overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μU ml-1 lambda phosphatase (NEB), and 25 μU ml-1 apyrase (NEB)] ...
-
bioRxiv - Immunology 2023Quote: ... containing 1 mM sodium orthovanadate (NEB, # P0758S). The membrane from the transwell inserts was cut using forceps and placed in 300 µL of 1X cell lysis buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-H3K9la (PTM BIOLABS, PTM1419RM, 1:1000), anti-H3K14la (PTM BIOLABS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 µL T4 PNK (NEB, #M0201L) for 30 to 60 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... in 1:10 CutSmart Buffer (BioLabs #B6004S) at 37°C for 1 hour ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1x NEB Glyco Buffer #1 (NEB) for 60 minutes at 37℃ ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 1× T4 DNA ligase buffer (NEB) for 30 min at 37 °C ...
-
Emergence of RNA-guided transcription factors via domestication of transposon-encoded TnpB nucleasesbioRxiv - Genetics 2023Quote: ... in 1× T4 DNA ligase buffer (NEB). Samples were column-purified using RNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Synthetic Biology 2023Quote: DNA ladder: 1 kb DNA Ladder (NEB) for gel electrophoresis
-
bioRxiv - Synthetic Biology 2023Quote: ... coli XL-1 Blue (New England Biolabs) and all sequences were confirmed by colony PCR and whole plasmid sequencing (Primordium Labs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... Torin at 1 µM (New England Biolabs), and Bafilomcyin at 10 nM (Sigma) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µL T4 DNA ligation buffer (NEB) 6.5 µL water ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µL of dNTPs (cat. #N0447, NEB), 0.5 µL of custom LNA-TSO [12 µM] (cat ...
-
bioRxiv - Biochemistry 2023Quote: ... 1× Q5 reaction buffer (New England Biolabs), 200 µM dNTPs (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 1 (New England Biolabs #B7030) at 30°C for 1 hour followed by column purification ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 unit of Phusion DNA Polymerase (NEB), as well as 10 pg of a pD-template ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 U T4 RNA ligase 1 (NEB), 50 mM Tris-HCl pH=7.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 µL Dnp1 restriction enzyme (NEB, #R0176S) was added to the PCR mixture and the sample incubated at 37 °C for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 1 volume of λ-Phosphatase (NEB) with 1 volume of water ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 mM ATP (P0756S, New England Biolabs) and 20 units of T4 Polynucleotide kinase (M0201L ...
-
bioRxiv - Genomics 2024Quote: ... 1 μL T4 DNA ligase (NEB M0202M), 15 μL nuclease-free water ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 IU Taq DNA polymerase (NEB). For detection of KPNA2 mRNA a forward primer in exon 1 (5’-GAA GGG TAG CAG ACG TTT CC-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... and T4 RNA Ligase 1 (NEB, #M0204S), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... 500 ng total RNA in a volume of 9 μl was ligated to 1 μl custom adapter mix (18S:28S ratio 1:2) using 1.5 μl T4 DNA ligase (New England Biolabs) in NEB next Quick ligation buffer (3 μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 µl of 10x RNase H reaction buffer and 1 µl (5 units) of RNase H (New England Biolabs) were added to 8 µl of the reaction mixture and incubation was continued for another 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Genomics 2022Quote: To digest linear DNA 1 μg of DNA sample was incubated in 50 μl with 1× NEBuffer 4 (NEB), 1mM ATP (NEB ...
-
bioRxiv - Genomics 2019Quote: ... and resuspended in 198 µL A-tailing solution (1× NEB buffer 2, 500 mM dATP, 1% Triton X-100). DNA ends were A-tailed by adding 1.5 µL Klenow (exo- ...
-
bioRxiv - Genomics 2019Quote: ... The embryos were treated with protease (1 µL of 25 µg/µL Qiagen Protease, 1 µL of 10x NEB Buffer 4 ...
-
bioRxiv - Genomics 2020Quote: ... 50 ng of DNA was incubated for 1 hour at 60 °C with 1 U BstUI and 0.5 uL 10x CutSmart buffer (New England Biolabs), in a total volume of 5.0 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... Cleavage fragments were resolved by 0.8% agarose gel electrophoresis with 1 μL of 1 kb Plus DNA Ladder (NEB) and visualized by ethidium bromide staining ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were incubated for 1 h at 37°C with 1 µl Endo H in GlycoBuffer 3 (NEB P0702S) after denaturing in SDS sample buffer prior to running SDS-PAGE.
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Supplementary Table 1) was digested in 200 µl of 1 × CutSmart buffer using 100 units of BsaI-HF (NEB) and 100 units of DraIII-HF (NEB ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... proteins (2 mg mL-1) were incubated with 180000 U mL-1 PNGase F (New England Biolabs, Unites States) in PBS (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Chromosomal DNA (1 µg) was digested with 10 units (1 µl) of restriction enzyme AciI (New England Biolabs (NEB)) for one hour at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µL of 1 µM Cas9 Nuclease (diluted from 20 µM stock in 1X NEBuffer r3.1) (NEB; catalog # M0386T), and 1X NEBuffer 3.1 (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... while the ter region was amplified using the primer pair 3778_ter 1 qPCR fwd with 3778_ter 1 qPCR rev and the Luna Universal qPCR Master Mix (New England Biolabs). Quantification of the ori/ter ratio was performed using the the 2-ΔCT method as described [62].
-
bioRxiv - Molecular Biology 2023Quote: ... in a 10 μL reaction in buffer (50 mM Tris-HCl pH 7.5, 1 mM DTT, 1 U/μL RNase Inhibitor (NEB)) and incubated for 1 hour at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR products were inserted into pET28a using restriction digestion and ligation with EcoR 1 and Sal 1 (NEB) sites.
-
bioRxiv - Microbiology 2023Quote: ... This digestion was performed on 1-3 µg of the PCR2 product with 1 µL of exonuclease (NEB #M0262) at 37°C for 30 min before heat inactivation ...
-
bioRxiv - Plant Biology 2023Quote: ... The precipitates were eluted into 30μL 1×SDS loading buffer and detected using anti-Myc and anti-MBP antibody (1:5,000, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... 12% PEG-8000, 1 mM dNTPs, 1 μM second strand synthesis primer (AAGCAGTGGTATCAACGCAGAGTGAATG, Sangon) and 0.125 U/μL Klenow exo- (BioLabs)) at 37 °C for 1 h with rotation ...