Labshake search
Citations for New England Biolabs :
951 - 1000 of 5113 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... The coding sequence of the human MPI gene was amplified by PCR using Phusion High-Fidelity DNA polymerase (M0530, New England BioLabs), a primer set (Supplementary Table S1) ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... full length coding sequences were amplified from human cell line cDNA with AttB overhangs using Phusion High-Fidelity DNA polymerase (M0530S, New England BioLabs) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The two strands of the gRNA were annealed and cloned downstream of the human U6 promoter using the BbsI (NEB) restriction site in the plasmid pU6-(BbsI)_CBh-Cas9-T2A-BFP (Addgene) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... low passage HEK293T cells were co-transfected a dual Cas9 and gRNA expression vector (pX330-T2) targeting the human AAVS1 locus71 and a PmeI-linearized (NEB) repair template comprising a constitutively expressed YFP-HygR-expression cassette with a BxB1 attP recognition site flanked by 800bp homology arms for the human AAVS1 locus (pROC079) ...
-
bioRxiv - Cancer Biology 2022Quote: Codon-optimized sequences encoding the DNA-binding domains of human BATF (AA 28-87) and JUNB (AA 269-329) were cloned into pMAL-C2X (NEB). The sequence encoding human IRF4 DBD (AA 19-120 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Immunology 2023Quote: ... PCR products were purified and cloned into human-IgG (Heavy, Kappa or Lambda) expression plasmids32 using the Gibson Assembly Master Mix (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... W165F and S169A) were introduced into human PSEN1 cDNA cloned into the pMSCVpuro vector using Q5 Site-Directed Mutagenesis Kit (NEB BioLabs) according to the standard protocol ...
-
bioRxiv - Biophysics 2023Quote: The RAMANK regions of the four human Notch paralogues (Table S3) were subcloned into the pMAL-c2x expression vector using HiFi DNA Assembly (New England BioLabs). Constructs were expressed in BL21(DE3 ...
-
bioRxiv - Cell Biology 2024Quote: ... was inserted into murine Shh between amino acids 92N and 93T (corresponding to N91 and T92 in human Shh) by using Gibson assembly (HiFi Assembly Kit, NEB). Where indicated ...
-
bioRxiv - Neuroscience 2024Quote: ... were cloned N-terminally to human CISD1 and point mutations introduced by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis kit (NEB). All plasmids were sequence verified ...
-
bioRxiv - Molecular Biology 2024Quote: ... The mCherry gene was excised from pL1694 by BamHI and NotI and replaced by a human codon-optimised spCas9 from pUF1-Cas912 by Gibson cloning (NEBuilder HiFi DNA Assembly Master Mix, New England Biolabs, NEB) to generate pL1694-GIMO-Cas9.
-
bioRxiv - Cell Biology 2024Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: Regulatory elements were amplified from mouse genomic DNA with Q5 polymerase (NEB, M0491) using primers listed in Table S8 and cloned into pGL4.24[luc2P/minP] (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... and capped and 2’-O-methylated with Vaccinia Capping System (NEB Biolabs). LNA oligos were transfected into unlabeled 4T1 cells using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... 0.75 M NaCl) and 2 μl protein kinase K (NEB, Ipswich, USA) during 2 h at 60 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mU of phosphodiesterase II from Sigma (# P9041-10 UN) and 2 U of alkaline phosphatase from Biolabs (# M0290) were added and the mixture was incubated at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and 2 μl of 1.5 μM NEBNext adaptors for Illumina sequencing (NEB): 5’-phos-GATCGGAAGAGCAC-ACGTCTGAACTCCAGTC/ideoxyU/ACACTCTTTCCTACACGACGCTCTTCCGATC*T-3’ and 5’-phos-GATCGGAAGAGCACACGTCTGAACTCCAGTC/ideoxyU/AC-ACTCTTTCCTACACGACGCTCTTCCGATC*C-3’ (* ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mM MgCl2 and 4 units of RNase Inhibitor Murine (NEB, M0314). After 30 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.25 μL of Phusion Hot Start DNA polymerase (2 unit/μL; NEB), 5 μL of 5x Phusion buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37 °C ...
-
bioRxiv - Genomics 2020Quote: ... Agarose was subsequently degraded by adding 2 μl of β-agarase (Biolabs). To stretch DNA fibers ...
-
bioRxiv - Genomics 2019Quote: ... 2 µg of DNA were digested for 4 hours with MmeI (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... For that the mix containing 2 µL of RNAse H (NEB, #M0297S), 1 µL of E ...
-
bioRxiv - Biochemistry 2019Quote: ... 400ng of library was amplified for 2 rounds using standard Phusion (NEB) PCR conditions ...
-
bioRxiv - Biochemistry 2019Quote: ... The protein was then passed over a 2 mL amylose column (NEB) and washed with 3 CV of Flag Wash Buffer ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Biophysics 2021Quote: ... Handle 2 was then digested with Lambda Exonuclease (M0262, New England BioLabs), which removes nucleotides from linearized double-stranded DNA in the 5′ to 3′ direction ...
-
bioRxiv - Biochemistry 2020Quote: ... 186 bp DNA (0.4 mg/ mL) in 1x NEBuffer 2 (NEB: B7002) was incubated with dATP (100 μM) ...
-
bioRxiv - Biochemistry 2020Quote: ... was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S) for 1 hour with shaking (1250 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μM of 7MeGpppA or GpppA RNA cap analogue (New England Biolabs), 10 μM adenosyl-methionine (AdoMet ...
-
bioRxiv - Microbiology 2019Quote: ... (2) DSBs blunting with NEB’s Quick Blunting Kit (NEB, cat. number: E1201); (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR amplifications were carried out using 2 x Q5 Master Mix (NEB), with cycling times and temperatures according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... and further passivated with 2 mg/ml Bovine serum albumin (BSA, NEB:B9000S) to prevent non-specific binding of proteins and DNA to the surface ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) before 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Genetics 2022Quote: ... 2 μg of total RNA was treated with DNase (New England Biolabs) and for the RT-qPCR experiment ...
-
bioRxiv - Genomics 2022Quote: ... followed by reverse-crosslinking with 2 ug/uL proteinase K (NEB, P8102), 1% SDS ...
-
Recurrent but short-lived duplications of centromeric proteins in holocentric Caenorhabditis speciesbioRxiv - Evolutionary Biology 2022Quote: ... RNA was treated with DNase I (New England Biolabs, 2 units/μl) at 37°C for 60 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... beads were resuspended in 50 μL of 1X NEBuffer 2 (NEB, B7002S) containing 0.1 mM dATP and 15 units of Klenow Fragment (3’→5’ exo- ...
-
bioRxiv - Molecular Biology 2020Quote: ... We loaded genomic digests and 100ng of 2-log ladder (NEB N3200) onto a 1% agarose gel and subjected it to electrophoresis in 1XTTE overnight at 49V ...
-
bioRxiv - Immunology 2022Quote: ... a quantitative PCR reaction (10 µl 2 x PCR master mix (NEB), 1 x SYBR green (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... followed by 2 μL of 20 mg/mL RNaseA (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... and cloning was performed using the Gibson Assembly 2× Master Mix (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... consisting of 50 μl 2× Q5 Hot-Start MasterMix (New England Biolabs), 2 μl of the corresponding sample-specific ...
-
bioRxiv - Molecular Biology 2020Quote: ... and once with 2 bead volumes of 1X RNase H Buffer (NEB; 50mM Tris-HCl ...
-
bioRxiv - Biophysics 2019Quote: ... ligated using T4 DNA ligase 2 purchased from New England Biolabs (NEB), USA ...
-
bioRxiv - Synthetic Biology 2019Quote: ... consisting of 37.5 µl 2× Q5 Hot-Start MasterMix (New England Biolabs), 2.5 µl of the corresponding sample-specific ...