Labshake search
Citations for New England Biolabs :
51 - 100 of 1741 citations for Recombinant Human ROR1 protein His tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: Recombinant RfxCas13d proteins were expressed in E.coli NiCo21(DE3) (NEB C2529). Cells were grown in 1L of lysogeny (Luria-Bertrani ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... MBP-tagged CCDC22 and CCDC93 proteins were purified using Amylose beads (New England Biolabs), mixed in approximately 1:1 stoichiometry ...
-
bioRxiv - Cell Biology 2022Quote: ... was expressed as maltose-binding protein-tagged fusion protein using the pMAL(tm)c5X-vector (New England Biolabs, Ipswich, USA). The coding DNA sequence was amplified by PCR using gene-specific primers (for primer sequences ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5 µg of purified recombinant WRN protein was treated with Lambda Protein Phosphatase (LPP, New England Biolabs) in 1X PMP buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns of MBP-tagged fusion proteins were performed using an amylose resin (New England Biolabs). Appropriate amounts of (see Fig ...
-
bioRxiv - Biochemistry 2022Quote: ... a tolerant position was mutated to facilitate making a labeled LexA variant.56 The His-LexA W201C mutant was generated using a Q5 Site-Directed Mutagenesis Kit (NEB) and the mutation was confirmed via sequencing ...
-
bioRxiv - Biochemistry 2020Quote: ... His-SNAP-EB3 proteins were then coupled to SNAP-Cell 647-SiR dye (NEB) by incubation at 37°C for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... MBP-tagged protein was captured by gravity flow affinity chromatography using amylose resin (New England Biolabs). Captured protein was washed with wash buffer (50mM Tris/HCl pH 7.6 ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: Codon-optimized human TDP-43-His LIC-A constructs were transformed into T7 express (New England Biolabs, #C3029J) E ...
-
bioRxiv - Immunology 2019Quote: ... Gel filtered proteins were labeled with either SNAP-Cell 505 (NEB, catalog S9103S) or SNAP-Cell TMR (NEB ...
-
bioRxiv - Plant Biology 2019Quote: ... Recombinant proteins were purified using gravity flow columns with amylose resin (New England Biolabs). MBP cleavage was performed by incubation in cleavage buffer (50 mM Trizma-HCl ...
-
bioRxiv - Plant Biology 2021Quote: Recombinant proteins from Escherichia coli lysates were immobilized on amylose resins (New England Biolabs), incubated for 1 h at 4 °C with purified GST-SH3P2 ...
-
bioRxiv - Plant Biology 2022Quote: ... For recombinant protein expression we used GW versions of pMAL-C2 (New England Biolabs) and pDEST-17 (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... The recombinant proteins were affinity purified through GST tag binding to amylose resin (BioLabs) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... The recombinant proteins were then incubated with MBP amylose magnetic beads (New England Biolabs) for 1 h at 4°C and washed with 200 mM NaCl ...
-
bioRxiv - Neuroscience 2024Quote: HA-tagged BirA-Tau fusion proteins were generated by using the NEBuilder™ HiFi DNA Assembly Kit (NEB). To this end ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified protein was labeled with SNAP-Surface Alexa Fluor647 dye (New England Biolabs). The fractional dye labeling and DNA binding activity were assessed as previously described [12].
-
bioRxiv - Microbiology 2021Quote: Recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). For all proteins except PP1γ ...
-
bioRxiv - Cell Biology 2021Quote: ... Ribonucleoprotein (RNP) complexes were formed from sgRNA and recombinant Cas9 2NLS protein (New England Biolabs) mixed at a sgRNA to Cas9 ratio of 4.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... His-TAD1 fusion proteins were purified according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA, USA). The bait protein GST-WL1 was incubated with GST beads (GE Healthcare ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was labeled with SNAP-Surface Alexa Fluor 647 labeling kit (New England Biolabs) according to the protocol provided by the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: All recombinant proteins were expressed in Escherichia coli T7 Express lysY/Iq cells (New England Biolabs). Except for GST-PP1γ ...
-
bioRxiv - Neuroscience 2024Quote: ... and used to form ribonucleoprotein (RNP) complexes when combined with recombinant Cas9 protein (New England Biolabs). Ribonucleoprotein complexes were formed using the method of Kouranova49 ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at room temperature before being incubated with 1.0 µg/mL of recombinant human histone H3.1 (New England Biolabs, #M2503S) or GST-fusion proteins for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: 30 uL of tagged Fluc-WT proteins were incubated with Factor Xa (NEW ENGLAND BioLabs, final concentration 67 ug/mL) for 2 hours or overnight on ice.
-
bioRxiv - Cell Biology 2019Quote: ... To visualize SNAP-tagged dCENP-A proteins cells were labelled with 3 µM SNAP-Cell TMR Star (New England Biolabs) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: Expression vectors encoding His6/SUMO-tagged SAHS proteins were obtained from Twist Bioscience and transformed into LEMO21(DE3) competent cells (New England Biolabs) according to the provider’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... myc-tagged AP3B1 immunoprecipitated and immobilised on Protein G-sepharose beads was incubated with CK2 (250 units; New England Biolabs) for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... SNAP-FOR1(3P,FH2) protein was labeled with SNAP-549 dye (New England Biolabs, Ipswich, MA) as per manufacturer’s instructions prior to each TIRF experiment.
-
bioRxiv - Cell Biology 2022Quote: Recombinant condensin II holo(WT) at 500 nM was mixed with or without λ protein phosphatase (NEB) at a final concentration of 400 U/µL in 1x NEBuffer for Protein MetalloPhosphatases supplemented with 1 mM MnCl2 and incubated at 30°C for 60 min ...
-
bioRxiv - Microbiology 2024Quote: Ubiquitination reactions containing recombinant GST-PKN1 were immunoprecipitated using protein G-conjugated magnetic beads (New England Biolabs). Beads were prepared by washing three times with IP wash buffer (PBS + 0.1% Tween-20) ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant human ADAMTSL2 constructs where generated by PCR-amplification with the Q5 Hot start high fidelity 2x master mix (NEB) and specific primer pairs to allow for restriction cloning ...
-
bioRxiv - Cell Biology 2024Quote: ... and 200 μM each of dATP/dCTP/dTTP at 21°C for 10 min and an additional 15 min incubation with 25 nM recombinant human RPA (a gift from Sarah W. Cai) and 0.03 U/μl T4 DNA polymerase (NEB, #M0203) at 37°C ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP-tagged and Halo-tagged versions of TBK1 constructs were generated by inserting SNAP (pSNAPf [New England Biolabs]) or (Halo [pHaloTag vector ...
-
bioRxiv - Microbiology 2021Quote: ... which were incubated with 1 μg/ml full-length S protein with His tag that had been pretreated with or without FXa (P8010L, NEB) for 2 hours at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant fusion proteins were purified via affinity chromatography from bacterial extracts using amylose resin (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified sgRNAs targeting tlnrd1 and slc45a2 were pooled separately and complexed with recombinant Cas9 protein (New England Biolabs) in vitro using 300mM KCl buffer for 5 minutes at +37°C ...
-
bioRxiv - Molecular Biology 2023Quote: NSD1/2 WT and different cancer mutants (3.4 μM) were mixed with recombinant H3.1 protein (1 μg) (purchased from NEB) or recombinant H3.1 mononucleosomes in methylation buffer (50 mM Tris/HCl ...
-
bioRxiv - Neuroscience 2022Quote: All anti-tau monoclonal antibodies were generated by the hybridoma approach against recombinant tau aggregates (human full-length tau) encapsulated in the ACM Polymersomes (ACM Biolabs, Singapore) and purified by size exclusion chromatography (SEC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins (except from cells expressing eGFP and cytoplasmically tagged EGFR) were further treated with 250 U of PNGase F (NEB, Cat# P0704) for 1 hour at 37 °C ...
-
bioRxiv - Developmental Biology 2020Quote: A digoxin-labeled human H19X probe was transcribed in situ from a linear template plasmid by T7 RNA polymerase (NEB, UK) with Digoxin-labeled Uridine (Roche ...