Labshake search
Citations for New England Biolabs :
8051 - 8100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 3.5 µl of Klenow Fragment (NEB) was added and incubated at 37℃ for 2 hours.
-
bioRxiv - Genomics 2023Quote: ... vector that removed the original scaffold sequence (referred as CRISPRmap-CROPseq) using NEBuilder HiFi DNA Assembly (New England Biolabs E2621). Next ...
-
bioRxiv - Genomics 2023Quote: ... resuspended with T4 DNA ligation mastermix (40 µl of T4 DNA Ligase Reaction buffer (NEB), 10% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Immunology 2023Quote: ... and BspEI (New England Biolabs, R0540) were used to clone the scFv fragment in a vector optimized for mRNA expression (pDA ...
-
bioRxiv - Immunology 2023Quote: Plasmids with CAR constructs were linearized by digestion with the restriction enzyme SalI (New England Biolabs). mRNA was produced using the mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit ( AMB13455 ...
-
bioRxiv - Immunology 2023Quote: ... the restriction enzymes BamHI-HF (New England Biolabs, R3136) and BspEI (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: The reagents used were as follows: Q5® Site-Directed Mutagenesis Kit (NEB), Gibson Assembly® Master Mix (NEB) ...
-
bioRxiv - Biochemistry 2023Quote: ... while the other was digested at 25 °C with 10 units SwaI (New England Biolabs). Enzymes were inactivated at 65 °C for 20 min ...
-
bioRxiv - Biochemistry 2023Quote: ... TrpB variants were amplified using Q5 2x MM (NEB): 98°C for 2 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... TrpBK82A was prepared using site-directed mutagenesis (NEB), according to protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... thermostable Inorganic Pyrophosphatase (0.0083 U/µL, New England Biolabs, M0296), and T7 RNA Polymerase (purified in-house) ...
-
bioRxiv - Biochemistry 2023Quote: ... GST-KRAS was created with standard Gibson Assembly (NEB) procedures with pGEX2T as the vector and the following primers ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA Cap 2’-O-methyltransferase (NEB, M0366S). Then ...
-
bioRxiv - Biochemistry 2023Quote: ... EcoRI and AseI in buffer II (NEB) and the insert was subcloned into pUC18 ...
-
bioRxiv - Biochemistry 2023Quote: ... PCR fragments were cloned into plasmid via Golden Gate with BsaI-HF v2 or Gibson assembly (New England Biolabs, Gibson Assembly Protocol (E5510)) ...
-
bioRxiv - Bioengineering 2023Quote: ... Purple (6X) (New England Biolabs) and loaded in a 2% Agarose gel containing SYBR Safe DNA gel stain (Thermofisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... Rectangle DNs were folded with 10 nM of M13mp18 ssDNA scaffold (Bayou Biolabs, P-107) and annealed in 20x excess staples ...
-
bioRxiv - Bioengineering 2023Quote: ... Constructs were assembled by Gibson assembly using the Gibson Assembly® Master Mix (New England Biolabs) or by Golden Gate assembly ...
-
bioRxiv - Bioengineering 2023Quote: ... Coli Poly (A) Polymerase (NEB, M0276L). Before capping and after polyadenylation ...
-
bioRxiv - Bioengineering 2023Quote: ... The mRNA underwent subsequent capping with the cap1 structure using the Vaccinia Capping System (NEB, M2080S) and mRNA Cap 2’-O-methyltransferase (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli strain NEB10β (New England Biolabs, MA) was used for all cloning experiments ...
-
bioRxiv - Biochemistry 2023Quote: ... All disease variants were introduced using a Q5 site-directed mutagenesis kit (NEB, E0554S).
-
bioRxiv - Molecular Biology 2023Quote: ... Linear DNA fragments were methylated at their ecoRI sites with ecoRI methyltransferase (New England Biolabs) and transformed into C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1X T4 RNA ligase reaction buffer (NEB #B0216S) for 16 hours at 16°C ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by DpnI (NEB) incubation at 37 °C for 1 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting solution was cooled down to 42°C before adding 2 U of β-agarase (NEB), gently mixing the solution by end-over-tube inversion ...
-
bioRxiv - Biochemistry 2023Quote: ... SC003_BsaI and p88_BsaI fragments were treated with restriction enzyme BsaI-HF®v2 (NEB #R3733S) while SC003_SfiI fragment and dsDNA p88-SDB vector were treated with restriction enzyme SfiI (NEB #R0123S ...
-
bioRxiv - Plant Biology 2023Quote: ... coli strain (New England Biolabs). Primers used for cloning are detailed in Supplemental Table 1.
-
bioRxiv - Developmental Biology 2023Quote: ... Radioactively labeled probes were generated by annealing complementary EMSA oligonucleotides (45 µM, NEB2 buffer (NEB), heating to 95° for 2 min and cooling down to 25° with −1°C per minute) ...
-
bioRxiv - Biochemistry 2023Quote: ... while SC003_SfiI fragment and dsDNA p88-SDB vector were treated with restriction enzyme SfiI (NEB #R0123S) and then gel purified ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Q5 Site-Directed Mutagenesis Kit (NEB) was used according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... using the plasmid pSP73-JY0 as template (55) followed by digestion with the restriction enzyme MluI (New England Biolabs). Labelled handles were ligated with the central part with T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... diluted 1:10 in PBS-BSA (PBS supplemented with 0.4 mg/mL BSA (New England Biolabs)) ...
-
bioRxiv - Biochemistry 2023Quote: ... and K723G).49 His/MBP-BRAF NTs were created with standard Gibson Assembly (NEB) procedure in the pET28-MBP vector from the following primers ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 strain resistant to phage T1 (New England Biolabs) harboring the pRARE2 plasmid and plated onto LB+Agar plates supplemented with kanamycin (Kan ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 ng pT-plasmid either carrying the blasticidin or the puromycin resistance marker and 1 unit HIFI Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer (05917131103 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... apyrase (NEB) was added to a final concentration of 25 mU/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) in 1× HiFi reaction buffer with MgCl2 (05917131103 ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... it was digested with DpnI (New England Biolabs) to remove template vector.
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was batch bound to a 15 mL of chitin resin (NEB) for 1 hour at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: Equal amounts (25 μg) of whole normal muscle extracts were incubated with 1 x Glycoprotein denaturing buffer (Biolabs) at 100 °C for 10 min to denature glycoproteins ...
-
bioRxiv - Cell Biology 2023Quote: ... in 1 x GlycoBuffer-2 (Biolabs). After incubation for 60 min at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... NEBNext Ultra II RNA Library Preparation Kit (New England BioLabs) for Illumina was used ...
-
bioRxiv - Biochemistry 2023Quote: ... and ligated into BamHI-HindIII digested pQE-80L using T4 DNA ligase (NEB, USA).
-
bioRxiv - Biochemistry 2023Quote: ... Reactions were quenched with the addition of an equal volume of 2X RNA loading dye buffer and 0.8 units of proteinase K from Tritirachium album (New England Biolabs Inc.) were added ...
-
bioRxiv - Biochemistry 2023Quote: ... was PCR amplified from pDONR221-SUMO2 plasmid (purchased from DNASU plasmid repository, United States) using Phusion® High-Fidelity DNA Polymerase (NEB, USA) with forward primer 5’ GATGGATCCATGGCCGACGAAAAG 3’ and reverse primer 5’ TTCAAGCTTTTAACCTCCCGTCTGCTG 3’ as per the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... was followed by cDNA synthesis (NEB, Invitrogen) and quantification of relative mRNA levels using a LightCycler 480 Instrument II (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... dGTP and 36 Units of T4 DNA polymerase (NEB) for 4 hours at 20°C ...