Labshake search
Citations for New England Biolabs :
8001 - 8050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... which underwent a restriction enzyme digest with XbaI (New England Biolabs, Ipswich, MT, USA) and HindIII (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... coli competent cells (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Genetics 2023Quote: ... PCR fragments were amplified using Phusion DNA polymerase (New England Biolabs) using the generic protocol and 30 s/Kb extension ...
-
bioRxiv - Genetics 2023Quote: ... we employed NEBuilder (New England Biolabs) to fuse PCR products ...
-
bioRxiv - Neuroscience 2023Quote: ... The I304N mutant FMRP was generated using Q5 Site-Directed Mutagenesis Kit (NEB). G3BP1-GFP plasmid was a gift from Jeff Chao (Addgene plasmid #119950) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ug of DNA was incubated with 6U RNAse H (NEB, M0297) at 37 °C for 2 h ...
-
bioRxiv - Microbiology 2023Quote: ... The expression plasmid was assembled via Gibson Assembly by mixing pETDuet-1 vector digested with NdeI and PacI with the gBlock in addition to Gibson Assembly Mix (NEB #E2611L) and incubating at 50°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: NINL (1-702) containing an amino-terminal HaloTag was expressed in BL-21[DE3] cells (New England Biolabs), which were then grown until OD 0.4-0.6 and induced with 0.1 mM IPTG for 16 hr at 16°C ...
-
bioRxiv - Zoology 2023Quote: ... or the Genome Institute of Singapore (GIS) using NEBNext DNA Library Preparation Kits (NEB). Paired-end sequencing was performed on Illumina Miseq (2x300-bp or 2x250-bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by the Monarch™ Total RNA Miniprep Kit (New England BioLabs) applying the manufacturer’s protocol for TRIzol® extracted samples ...
-
bioRxiv - Molecular Biology 2023Quote: ... and afterwards subjected to reverse transcription using ProtoScript® II Reverse Transcriptase (NEB). Synthesized cDNA from each fraction was used as a template in qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reactions were performed as technical triplicates using Luna® Universal qPCR Master Mix (NEB). Primers listed in Tab S9 were used for amplification of mitochondrial cob ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was reverse transcribed using ProtoScript II Reverse Transcriptase (NEB) and random primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Two hundred nanograms of RNA was used to generate sequencing libraries using the NEBNext® Multiplex Small RNA Library Prep Set for Illumina® Kit (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×HA-DHFR cassette was amplified from the resulting vector by Q5 polymerase (NEB) using primers containing a 50 nt overlap homologous to the either upstream or downstream regions of the TGRH88_003980_t1 stop codon (primers “flank fwd Tgurpl11m tagging” and “flank rev Tgurpl11m tagging” in table S9 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli (New England Biolabs, Inc.) in 300 ml of Luria-Bertani broth supplemented with Kanamycin (50 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric constructs of both syntaxin isoforms were obtained using Gibson Assembly (NEB). For the viral infection the cDNA of mouse Stx1A (NM_016801.4) ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR products were digested with Hpy166II (R0616S, NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... The amplicon was digested with the restriction enzyme CviQI according to manufacturer’s instructions (New England Biolabs). The enzyme digested the 119nt amplicon from the Z allele to produce fragments of 43 and 76nt ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted from zebra finch and chicken embryos using QIAgen RNeasy kit and transcribed into cDNA using LunaScript RT (NEB #E3010). PCR was performed using chicken or zebra finch cDNA and gene specific primers (Supplemental table 33) ...
-
bioRxiv - Cell Biology 2023Quote: ... site-directed mutagenesis was done using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) as directed by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The obtained inserts and mCherry-N1 were digested with restriction enzymes (NheI and EcoRI, New England Biolabs) then ligated with T4 DNA ligase (ThermoFisher ...
-
Reduction of chromosomal instability and inflammation is a common aspect of adaptation to aneuploidybioRxiv - Cell Biology 2023Quote: ... The PCR products were treated with exonuclease I (Biolabs, M0293S) and were subjected to Sanger Sequencing using the forward primer and analyzed by the TIDE method (68) ...
-
bioRxiv - Cell Biology 2023Quote: All plasmids used in this study were constructed using the NEBulider (New England Biolabs, Ipswich, USA; Cat #E2621L) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... coli (New England Biolabs) was transformed with the resultant DNA of the In-Fusion reaction by GenePulserII (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... via digestion with NheI and MluI in CutSmart buffer (New England Biolabs). The HA-hTRIM28 construct was then ligated into the multiple cloning site (MCS ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Cell Biology 2023Quote: ... an NEB Q5 SDM kit (NEB, E0554S) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared with 0.1-1 µg of total RNA using the Protoscript First Strand cDNA Synthesis kit (New England Biolabs; Catalogue #E6560L) as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were constructed with the NEBNext® Ultra™ II DNA Library Prep Kit (New England Biolabs, #E7645S) and sequenced on an Illumina HiSeq 3000 platform to generate a minimum of 20 million 150-bp reads per sample.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries were constructed with the NEBNext® Ultra™ II Directional RNA Library Prep Kit (New England Biolabs, #E7760S) and sequenced on an Illumina NextSeq2000 platform to generate a minimum of 25-30 million 150-bp paired-end reads per sample.
-
bioRxiv - Immunology 2023Quote: ... The pDNA was digested using BsmBI-v2 restriction endonuclease (NEB), followed by purification of the product by phenol-chloroform extraction and ethanol precipitation ...
-
bioRxiv - Genomics 2023Quote: ... Both libraries were ordered as synthesized oligo pools (Integrated DNA Technologies) and PCR-amplified with Q5 DNA polymerase (New England Biolabs M0492) using an optimized two-round amplification strategy to minimize barcode-sgRNA recombination ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA or immunoprecipitated RNA (MIWI or MILI) was de-phosphorylated with Shrimp Alkaline Phosphatase (M0371, NEB) and end-labeled using T4 polynucleotide kinase (M0201 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and end-labeled using T4 polynucleotide kinase (M0201, NEB) and [γ-32P] ATP (NEG002A250UC ...
-
bioRxiv - Developmental Biology 2023Quote: ... WGA DNA was subsequently processed for Illumina library sequencing preparation using TruSeq indexing of the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs). NEBNext Multiplex Oligos for Illumina (96 index primers ...
-
bioRxiv - Developmental Biology 2023Quote: Small RNA libraries from immunoprecipitated RNAs or total RNA were prepared using Small RNA Library Prep Kit (E7300, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The sample was lysed in HiChIP lysis buffer and digested with MboI (NEB) for 4 h ...
-
bioRxiv - Genomics 2023Quote: ... and mRNA was isolated with NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs E7490L). RNA integrity number (RIN ...
-
bioRxiv - Genomics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1) (New England BioLabs E7416). DNA libraries were quality checked with DNA 1000 assay (Aligent 5067-1504 ...
-
bioRxiv - Genomics 2023Quote: ... The poly-A+ fraction of RNA was isolated using Oligo d(T)25 Magnetic Beads (New England BioLabs Inc.) following the commercial protocol for Mammalian Cells provided by the manufacturer ...
-
bioRxiv - Genomics 2023Quote: Immuno-precipitated DNA samples at an input amount of 2-100 ng were subjected to Illumina fragment library preparation using the NEBnext Ultra II DNA library preparation chemistry (New England Biolabs, E7370L). In brief ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries for Next Generation Sequencing were prepared with NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs E7775) and NEBNext Multiplex Oligos for Illumina (Unique Dual Index UMI Adaptors RNA Set 1 ...
-
bioRxiv - Genomics 2023Quote: ... and for tissue (NEB T3060L), following manufacturer’s instructions and introducing few technical improvements ...
-
bioRxiv - Genomics 2023Quote: ... was extracted from hTERT RPE-1 dry cell pellets using the Monarch HMW DNA extraction kit for cells & blood (New England Biolabs, NEB T3050L) and for tissue (NEB T3060L) ...
-
bioRxiv - Genomics 2023Quote: ... was extracted from hTERT RPE-1 dry cell pellets using the Monarch HMW DNA extraction kit for cells & blood (New England Biolabs, NEB T3050L) and for tissue (NEB T3060L) ...
-
bioRxiv - Genomics 2023Quote: ... pHia5ET was transformed into T7 Express lysY/Iq Escherichia coli cells (NEB C3013I). Overnight cultures were added to two 1 L cultures of LB medium supplemented with 50 µg/mL kanamycin and grown with shaking at 37°C to an OD600 of 0.8-1.0 ...
-
bioRxiv - Genetics 2023Quote: ... DNA was amplified with Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs; catalog no. M0494S). For the 1st stage PCR ...
-
bioRxiv - Genetics 2023Quote: ... and p.V126V were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs, Ipswich, MA; catalog no. E0552). Primers used for site-directed mutagenesis are given in Appendix 1-table 7 ...
-
bioRxiv - Genetics 2023Quote: Twenty nonfunctional 9 base pair barcodes “CellTags” were subcloned into pLentiV_Blast using Q5® Site-Directed Mutagenesis kit (New England Biolabs; catalog no. E0552) (Biddy et al. ...