Labshake search
Citations for New England Biolabs :
701 - 750 of 6280 citations for 7 Methyl 1 2 3 4 tetrahydroisoquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... siRNA resistant mCherry-ALG-2 was created by mutagenesis (primers sequences 5’-ATTTCGATGTTTGACCGTGAGAAC-3’, 5’-AATGGACCTGACAGTCACTGGATTAAA-3’) using a Q5 Site-Directed Mutagenesis Kit (E0554S, NEB). The plasmid encoding IST1-GFP is as described (63 ...
-
bioRxiv - Bioengineering 2023Quote: ... The β2-tubulin locus was amplified with the 1114A.S43 (5’ GAGAGCAACACTCGTGCG 3’) and 1114A.S44 (5’CAGGGTGGCATTGTACG 3’) primers and the amplicon was digested with Fspl (NEB cat#R0135S) or Ddel (NEB cat#R0175S ...
-
bioRxiv - Systems Biology 2023Quote: ... 3’ ends of RNA were modified to have 3’ OH groups compatible for ligation using T4 Polynucleotide Kinase (NEB, #M0201L). Beads were incubated at 37°C for 10 minutes with shaking at 1200 rpm on a ThermoMixer ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... and a pair of oligonucleotides (Forward, 5’-CACCGTCAATAATGAGGTGGTCCGA-3’; Reverse, 5’-AAACTCGGACCACCTCATTATTGAC-3’) was ligated with T4 DNA Ligase (M0202, New England BioLabs).
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2023Quote: The myo1g ORF was amplified from mixed stage pool of cDNAs using primers 5’-GATCCCATCGATTCGATGGCGGAGCTGGAGGGCTTG-3’ and 5’-AGGCTCGAGAGGCCTTACTGGGGCAGGAGTAAGG-3’ and cloned into the pCS2+ vector using Gibson assembly mix (NEB). Bold letters in the primer sequences indicate Gibson overhangs that are also present in the pCS2+ sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... branched DNA (which can be a consequence of the RCA) was resolved by a 1 hour incubation at 37°C with 4 μl T7 endonuclease (New England Biolabs) and re-purified using AMPure beads ...
-
bioRxiv - Genomics 2019Quote: ... we eluted the RNA by adding 4 µl of master mix containing 1 µl of 10 mM dNTPs (New England Biolabs), 0.1 µl of 100 µM 3’ SMART reverse transcriptase (RT ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... excess salts and enzymes were removed by centrifugation (600 g for 5 minutes at 4°C) and the cell pellet was re-suspended in 995 μl of 1 x ligation buffer (NEB) supplemented with BSA (100 μg/mL final concentration) ...
-
bioRxiv - Systems Biology 2022Quote: Expression vectors (SCRIPT 1-4; Supplemental Figure S1) were constructed by a Golden Gate reaction with BsaI (New England Biolabs) using the paired gRNA entry vectors and a destination vector as previously described (Decaestecker et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mixed diluted primers (1.7 μl) were combined with 1 μl of annealing buffer (10X NEBuffer 4, New England Biolabs Inc.) on ice in reaction tubes ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... by incubating the DNA construct (1 μg) with 4 units of SssI methylase and 160 μM S-adenosylmethionine (New England Biolabs) for 4 h at 37°C or mock-methylating by incubating in the absence of S-adenosylmethionine ...
-
bioRxiv - Molecular Biology 2023Quote: ... increasing volumes of SPRI beads were mixed with 1 μl of a 4-fold dilution of 100 bp DNA ladder (New England Biolabs) and diluted to a final volume of 100 μl with 10 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Microbiology 2023Quote: The eluted gDNA was resuspended by pipetting to make the beads and elution as homogenous as possible before 20 µL was used in a 40 µL digest using 1 µL of nucleoside digestion mix and 4 µL 10X buffer following the protocol for Nucleoside Digestion Mix (NEB) in an unskirted PCR plate ...
-
bioRxiv - Microbiology 2023Quote: ... was generated by amplifying 1 kb fragments upstream and downstream of the region (Table 4) and cloned into pKNOCK-bla-erm57 using NEBuilder (NEB). The plasmid was conjugally transferred into B ...
-
bioRxiv - Genomics 2023Quote: ... 30 minutes at 72°C and finally held at 4°C until 1 μl Exonuclease I (20U/μl, catalog num. M0293S, NEB) was added to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... Clarified lysates were incubated for 1 hour at 4 °C on a nutator with 40 µL amylose resin slurry (New England Biolabs) equilibrated with amylose wash buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Synthesized cDNA was then diluted 4-fold and 1 μL was used as template for real-time qPCR using Luna Master Mix (NEB). Values were normalized to GAPDH ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µL (12 units) M.SssI methyltransferase (NEB). This solution was pre-warmed to 37°C before addition to prevent interference with dCas9:gRNA binding to the DNA ...
-
A universal fluorescence-based toolkit for real-time quantification of DNA and RNA nuclease activitybioRxiv - Biochemistry 2019Quote: ... Klenow Fragment (3’ → 5’ exo-; New England Biolabs), RNase A (Thermo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... in NEB buffer #3 (New England Biolabs, B7003S) for 30 min at 37°C and then ethanol-precipitated after phenol:chloroform and chloroform extraction ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 units of T4 DNA polymerase (NEB, M0203S), 1 unit of Klenow Enzyme (NEB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 μl 10 mM dNTP mix (N0477, NEB), and 3 μl Klenow Fragment (exonuclease-deficient ...
-
bioRxiv - Molecular Biology 2022Quote: ... and dephosphorylated with 3 units rSAP (NEB, M0371) with 6 μl CutSmart Buffer (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μL USER Enzyme (NEB, Ipswich, MA, UK) was incubated with size-selected ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Then 3 μl USER™ Enzyme (NEB, USA) was used with size-selected ...
-
bioRxiv - Biochemistry 2019Quote: ... and 4ul of 10X NEB buffer 3 (NEB) was added to the reactions and incubated for an extra 20 min at 30°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 U WarmStart RTx Reverse Transcriptase (NEB, #M0380S), 0.2 μM F3/B3 primers ...
-
bioRxiv - Genetics 2020Quote: ... supplemented with 3 ul Proteinase K (NEB, P8107S). Samples were incubated for 1 hr at 56°C ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA 3’-ends were dephosphorylated using rSAP (NEB) and ligated to either the Universal miRNA Cloning Linker (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and then 3 µl USER Enzyme (NEB, USA) was used with size-selected ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µl of T4 polynucleotide kinase (NEB, M0201L) and 4 µl of terminal deoxynucleotidyl transferase (Enzymatics ...
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
bioRxiv - Molecular Biology 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (NEB) for 30 min at 37 °C and purified by QIAquick PCR Purification Kit ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µL volume of USER Enzyme (NEB, USA) was applied to the size-selected ...
-
bioRxiv - Plant Biology 2024Quote: ... A-tailed with Klenow 3’-5’ exo-(NEB), and truncated Illumina adapters were added with T4 DNA ligase (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3 µl 1,000 U/µl USER Enzyme (NEB), Ultrapure water (Thermo ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Genomics 2021Quote: ... nascent RNA samples were processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Cell Biology 2020Quote: ... primers 1 - 3) and then inserting the resulting PCR product into BamHI-digested pBMN-mCherry using Gibson assembly (New England Biolabs, Ipswich, MA). The resulting pBMN-ARHGAP36-mCherry vectors with XhoI and SacII restriction sites were subsequently used in all experiments described herein.