Labshake search
Citations for New England Biolabs :
701 - 750 of 3522 citations for 6 Ethyl 1H indole 2 3 dione 3 O 4 4 4 trifluoro butyl oxime since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... As a positive control, a concentration range (0.25, 1, 4, 16 units) of Dam enzyme was used (New England BioLabs #M0222S). Next ...
-
bioRxiv - Microbiology 2021Quote: ... Cell debris was removed by centrifugation at 15,000 x g for 30 min at 4°C and the clarified extract was loaded onto a chitin resin (NEB) column pre-equilibrated with column buffer for purification at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20 μl of each clean digestion product were split equally in two 0.2 ml PCR tubes (15 μl in each) and 4 μl of Adaptor ligation buffer (5x T4 DNA Ligase Buffer (New England Biolabs) and 10 μM of the dsAdR adaptor along with 1 μl (400 U ...
-
bioRxiv - Microbiology 2019Quote: ... Both pBAMD1-4 and the insert were digested with EcoRI-HF and SwaI-HF (New England Biolabs #R0604S and # R3101S), ligated ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Nanopore library was prepared using Oxford Nanopore Technologies ligation sequencing kit (SQK-LSK108) from 4 μg of T7 endonuclease I (New England Biolabs) treated WGA ...
-
bioRxiv - Genomics 2020Quote: ... sticky-ended DNA was incubated in 1x T4 DNA ligase buffer with 4 μl (400 U/μl) of T4 DNA Ligase (NEB) in a final volume of 200 μl at 16°C overnight ...
-
bioRxiv - Genomics 2019Quote: ... Annealing was performed by mixing equimolar amounts of forward and reverse oligonucleotides at 100 pmol/µl with NEBuffer 4 (New England Biolabs), heating 5 minutes at 95°C and allowing the mix to cool down slowly to room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... branched DNA (which can be a consequence of the RCA) was resolved by a 1 hour incubation at 37°C with 4 μl T7 endonuclease (New England Biolabs) and re-purified using AMPure beads ...
-
bioRxiv - Genomics 2019Quote: ... Double-stranded DNA donors for repair were prepared by mixing equimolar amounts of forward and reverse oligonucleotides at 100 pmol/µl with NEBuffer 4 (New England Biolabs), heating 5 minutes at 95°C and allowing the mix to cool down slowly to room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... Precipitated proteins were removed by centrifugation at 14000g for 30 min at 4°C and the remaining soluble protein was incubated with enterokinase light chain (NEB) for 16h at room-temperature as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Both 3' and 5' ligations were carried out with degenerate adaptors (each containing 4 random nucleotides) in the presence of 10% Polyethylene Glycol (PEG 8000, NEB) and 0.5 μL of Superasin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... we eluted the RNA by adding 4 µl of master mix containing 1 µl of 10 mM dNTPs (New England Biolabs), 0.1 µl of 100 µM 3’ SMART reverse transcriptase (RT ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Biophysics 2021Quote: ... The unbound MBP or 4 MBP that remained in the unbound fraction was then loaded on Amylose resin (New England Biolabs) previously equilibrated in buffer D ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences corresponding to the constructs shown in Figure 4 were purchased as gBlocks from IDT and cloned using Gibson cloning (NEB) into the BamHI site of the pYDL reporter ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was ligated by incubation at 16°C for 5h in 4 ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the ligation of the custom sequence adapters was done in solution by adding 4 μl adaptors (30 μM) and 1600 units T4 DNA ligase (NEB). The ligation was carried at for 2 hours at room temperature on a rotating wheel in 1x ligation buffer (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... excess salts and enzymes were removed by centrifugation (600 g for 5 minutes at 4°C) and the cell pellet was re-suspended in 995 μl of 1 x ligation buffer (NEB) supplemented with BSA (100 μg/mL final concentration) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’ UTR of Pir121 was PCR amplified from genomic DNA using the primers listed in Table S2 and cloned into pPT808 [4] using Gibson assembly (NEB). All plasmids used in this study are listed in Table S3.
-
bioRxiv - Cancer Biology 2020Quote: ... We performed eight 100 µl PCR reactions per sample (4 µg DNA per reaction) using Q5 High-Fidelity 2x Master Mix (New England Biolabs)28 to maximize library sequencing quality ...
-
bioRxiv - Systems Biology 2021Quote: ... We performed 4 PCRs per pool from cDNA and gDNA respectively using the Q5 High Fidelity 2X Master Mix (New England Biolabs), then pooled the PCRs and purified them ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The vector and the PCR insert were used to prepare 4 ligation reactions by mixing with T4 Ligase (New England Biolabs).
-
bioRxiv - Microbiology 2021Quote: ... cholerae H-NS protein was purified as previously described (4) using the IMPACT-kit (New England Biolabs, Catalogue No. #E6901S). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... the SYLF domain was mutagenized by ordering a synthetic DNA sequence carrying point mutations (Table 4) and replaced by restriction enzyme digestion with NcoI (NEB) and XbaI (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation began with the digestion of 1pg–200 ng genomic DNA in a 15-µl reaction using 4 U BcgI (NEB) at 37 °C for 3 h ...
-
bioRxiv - Systems Biology 2022Quote: Expression vectors (SCRIPT 1-4; Supplemental Figure S1) were constructed by a Golden Gate reaction with BsaI (New England Biolabs) using the paired gRNA entry vectors and a destination vector as previously described (Decaestecker et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were pre-incubated at 4°C for 30 min before addition of 100 uL equilibrated amylose resin (New England BioLabs). The mixture was incubated for 1h at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Mixed diluted primers (1.7 μl) were combined with 1 μl of annealing buffer (10X NEBuffer 4, New England Biolabs Inc.) on ice in reaction tubes ...
-
bioRxiv - Genetics 2019Quote: Total genomic DNA (4 μg) of cells collected at each time point was digested for 6h with EcoRV (40 U) (NEB) loaded on a 1% agarose gel (15×20 cm ...
-
bioRxiv - Biochemistry 2019Quote: ... Those fractions containing the protein of interest were pooled and incubated 30 minutes at 4°C with pre-equilibrated amylose resin (New England BioLabs) and eluted with elution buffer (30 mM HEPES pH 8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 μL of purified PCR products are used in a 40 μL IVT reaction using HiScribe T7 polymerase (NEB #E2040S) and containing 5 mM each NTPs (NEB # N0466S) ...
-
bioRxiv - Biochemistry 2021Quote: ... Each reaction was 400 µL total (split into 4 x 100-µL aliquots) and contained 1X Q5 reaction buffer (New England BioLabs), 200 µM dNTPs ...
-
bioRxiv - Biochemistry 2020Quote: ... eluted protein samples may be treated with TEV protease at 4 °C overnight before flowing through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Genomics 2019Quote: ... One million nuclei aliquots were pelleted by 1,000 x g at 4°C for 10 min and resuspended in 200 µl of GpC methyltransferase M.CviPI (NEB M0227L) reaction containing 1X GC Reaction Buffer ...
-
bioRxiv - Microbiology 2019Quote: ... The pBAMD1-4 plasmid was linearized by digestion with HindIII-HF and EcoRI-HF (New England Biolabs # R3104S and # R3101S) at 37 °C for 2 h in Cutsmart buffer ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Microbiology 2020Quote: ... was designed with 4 nt 5’ overhangs that match 5’ overhangs of the pCsm vector left by linearization with BbsI (NEB). 10 pmoles of each oligonucleotide set were annealed in 1X CutSmart buffer (NEB ...