Labshake search
Citations for Illumina :
1 - 50 of 884 citations for pVectOZ CAT Transfection control since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 50% PhiX Control v3 (Illumina, Cat#: FC-110-3001) was used as a spike-in ...
-
bioRxiv - Genetics 2023Quote: ... 10-20% PhiX control DNA (Illumina; cat. no. FC-110-3001) was spiked into the pooled 2 nM DNA amplicon library ...
-
bioRxiv - Genetics 2023Quote: ... 10-20% PhiX control DNA (Illumina; cat. no. FC-110-3001) was spiked into the pooled 2 nM DNA amplicon library ...
-
bioRxiv - Genomics 2019Quote: ... quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genomics 2023Quote: ... and combined with 50% PhiX spike-in control (Illumina, Cat# FC-110-3001). Single-end 300mer sequencing was then performed on a MiSeq platform (Illumina ...
-
bioRxiv - Pathology 2022Quote: ... The RNA resultant from RIP of heart tissue or resultant from NHDF transfection with hnRNPC siRNA and the respective control construct was sequenced on an Illumina Nextseq 550 sequencer (Illumina, CA, USA) to 25-35 million single-end 75bp reads and >50 million paired-end 75 bp reads per sample ...
-
bioRxiv - Genetics 2019Quote: ... 10% PhiX control library (Illumina v3 control library) was spiked in to facilitate sequencing by generating additional sequence diversity ...
-
bioRxiv - Neuroscience 2022Quote: ... with a 20% v/v PhiX Control v3 spike-in (Illumina, Cat. No. FC-110-3001) and sequenced on Illumina’s NovaSeq 6000 ...
-
bioRxiv - Genomics 2021Quote: ... PhiX Control (Illumina) was added at 1% to the pool as an internal control before sequencing.
-
bioRxiv - Genomics 2021Quote: ... PhiX control (Illumina) was added at a final concentration of 1% to the denatured library ...
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using Pair-end 2×100 cycle mode on the Illumina NovaSeq 6000 system (NovaSeq 6000 S1 Reagent Kit v1.5 200 cycles Illumina, cat. no. 20028317; 0.5% of the PhiX control library, Illumina, cat. no. FC-110-3001) and the standard clustering procedure.
-
bioRxiv - Biophysics 2022Quote: ... PhiX control library (Illumina) was added until the concentration was 20 pM ...
-
bioRxiv - Neuroscience 2021Quote: ... PhiX control library (Illumina) was spiked in at a final concentration of 15% to improve color balance in read 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... PhiX control library (Illumina) was spiked in at a final concentration of 15% to improve color balance in read 1 ...
-
bioRxiv - Genomics 2022Quote: ... PhiX control library (Illumina) was spiked in at a final concentration of 7.5% to improve color balance in Read 1 ...
-
bioRxiv - Genetics 2023Quote: ... PhiX Control v3 (Illumina) was spiked into the run at a concentration of 30% to improve cluster resolution and enable troubleshooting in the event of a run failure.
-
bioRxiv - Zoology 2019Quote: ... PhiX Control library (v2; Illumina) was added to the library ...
-
bioRxiv - Neuroscience 2021Quote: ... The control library phiX (Illumina) was spiked in at a final concentration of 15% to improve color balance in read 1.
-
bioRxiv - Cancer Biology 2021Quote: ... PhIX genome control library (Illumina) is included at 20-25% in each sequencing lane to improve cluster identification and base-balancing during sequencing ...
-
bioRxiv - Genetics 2022Quote: ... 50% PhiX Control v3 (Illumina) was used as spike-in and cluster density was intended to be ∼800-1000K/mm2.
-
bioRxiv - Microbiology 2022Quote: ... PhiX Control library (v3) (Illumina) was combined with the amplicon library (expected at 30%) ...
-
bioRxiv - Microbiology 2022Quote: ... PhiX control library (v3) (Illumina) was combined with the amplicon library (at a fraction of 30%) ...
-
bioRxiv - Neuroscience 2022Quote: ... PhiX control library (v3) (Illumina) was combined with the amplicon library (at a fraction of 30 %) ...
-
bioRxiv - Genomics 2023Quote: ... 20-30% PhiX control (Illumina) was included in each sequencing run.
-
bioRxiv - Bioengineering 2023Quote: ... PhiX Control library (v3) (Illumina) was combined with the amplicon library (expected at 20%).
-
bioRxiv - Microbiology 2020Quote: ... 10% PhiX was added as a sequencing run control (Illumina: Technical Note on PhiX Control). The MiSeq run was a paired-end 600 cycle sequencing run ...
-
bioRxiv - Physiology 2019Quote: ... Un-indexed control library PhiX (NextSeq™ PhiX Control Kit FC-110-3002 by Illumina) was denatured and diluted to 1.8 pM according to the “Denature and Dilute Libraries Guide” and used as a spike-in to provide improved nucleotide diversity.
-
bioRxiv - Genomics 2019Quote: ... Each sample library was uniquely barcoded and quantified by PCR using a PhiX Control v3 (Illumina, Cat #FC-110-3001) standard curve ...
-
bioRxiv - Genomics 2023Quote: ... The PhiX Control library was spiked in the sequencing sample at 10% (v/v) (Illumina, cat. no. FC-110-3001).
-
bioRxiv - Microbiology 2023Quote: ... All sequencing runs were performed with a spike-in of 1% PhiX control library V3 (Illumina, Cat. FC-110-3001). The sequencing mean library size was 134,629,540.5 reads [range ...
-
bioRxiv - Genomics 2021Quote: ... we performed another secondary analysis between two groups of control samples (Leicester study controls vs. Ottawa and ATVB controls) representing two main enrichment kits (Illumina ICE vs. Agilent SureSelect kits). The statistical analysis was performed in R 3.3.3 (55) ...
-
bioRxiv - Microbiology 2019Quote: ... including a 1% PhiX control spike-in prepared according to manufacturer’s instructions (PhiX Control v3, Illumina), and paired-end sequenced using a MiSeq instrument.
-
bioRxiv - Microbiology 2019Quote: ... and 30% PhiX Control v3 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... pooled with 15% PhiX control (Illumina), and sequenced on an Illumina NextSeq with a High output kit using a single end forward read (266 or 300 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on a Miseq Sequencer System (Illumina ...
-
bioRxiv - Genetics 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added to the pooled amplicon library prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10% PhiX Sequencing Control V3 (Illumina) was added prior to running the sample on an Miseq Sequencer System (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... contaminants (PhiX control V3 library, Illumina) were filtered and low quality ends were clipped off with BBDuk (39) ...
-
bioRxiv - Microbiology 2023Quote: ... The PhiX Control v3 (Illumina, USA) was added to the pool at 15% of the final concentration ...
-
bioRxiv - Microbiology 2020Quote: ... The sequencing quality control was done with on-board Miseq Control Software and Miseq Reporter (Illumina Inc.) and the obtained sequences were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Microbiology 2020Quote: ... mixed with 15% PhiX Control v3 (Illumina), and denatured according to the aforementioned Illumina protocol ...
-
bioRxiv - Immunology 2021Quote: ... PhiX Control V3 (Illumina, #FC-110-3001) was denatured and diluted to 20 pM and was added to the pooled library sample at a 1% spike in ...
-
bioRxiv - Cell Biology 2021Quote: ... PhiX Control v3 adapter-ligated library (Illumina) was spiked-in at 2% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Genomics 2022Quote: ... and 12% PhiX control library v3 (Illumina) was spiked into the library ...
-
bioRxiv - Genetics 2022Quote: ... control endometrium genome-wide expression (Illumina BeadChips) data set (Hawkins et al. ...
-
bioRxiv - Immunology 2020Quote: ... PhiX Run Control (Illumina, FC-110-3001) was included at 40% of the final DNA pool ...