Labshake search
Citations for Illumina :
1 - 50 of 790 citations for T Cell Surface Glycoprotein CD3 Gamma Chain CD3G Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: The DNA methylome data of HLA-DR+/CD3- and CD3+ cells was analyzed using the HumanMethylation450K (450K) BeadChip (Illumina, USA) array as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cell surface protein libraries were sequenced on the NextSeq 550 System (Illumina).
-
bioRxiv - Immunology 2022Quote: Single cell polymerase chain reaction (PCR) and custom molecular biology protocols generated NGS sequencing libraries (MiSeq, Illumina) using automated workstations (Bravo ...
-
bioRxiv - Cancer Biology 2022Quote: ... ScRNA-seq libraries were prepared using the Next GEM Chromium single cell 3′ reagent kits V3.1 with feature barcode technology for cell surface protein (10x genomics) and sequenced using NextSeq 500 high output kits and Novaseq S4 PE100 kits (Illumina). scRNA-Seq data after standard quality control was aligned to the reference genome (mm10 ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were sequenced on a HiSeq 2500 or HiSeq 3000 sequencing system (Illumina paired-end multiplexing run ...
-
bioRxiv - Systems Biology 2022Quote: ... we sorted 500-1000 clonally expanded HLA-A2/YFV NS4b-specific CD8+ T cells directly into 22.5μl of ATAC-buffer (12.5μl 2× TD Buffer (Illumina), 0.5μl 1% Digitonin (Promega G9441) ...
-
bioRxiv - Immunology 2022Quote: ... and T cell mRNA targeted libraries were pooled together before sequencing on a NovaSeq6000 instrument (Illumina). For sequencing ...
-
bioRxiv - Immunology 2020Quote: ... we obtained publicly available CD8+ T-cell derived genome wide DNA methylation profiles (K450 Illumina DNA methylation arrays) from two previously published adult patient cohort ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The biotin-labeled fragments were further enriched and sequenced by Illumina Novaseq ...
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Immunology 2024Quote: ... Live purified CD4+ T cells were processed using OMNI-ATAC protocol and libraries sequenced using NextSeq 500 sequencer (Illumina).
-
bioRxiv - Genomics 2019Quote: ... Biotin labeled DNA was pull-downed by streptavidin beads followed by Illumina adaptor ligation and PCR amplification ...
-
bioRxiv - Genomics 2020Quote: Whole-genome DNA methylation measurement was performed on DNA from purified CD4+ T cells using Infinium MethylationEPIC BeadChip (Illumina 850K array) by the Center for Applied Genomics Genotyping Laboratory at the Children’s Hospital of Pennsylvania ...
-
bioRxiv - Immunology 2024Quote: Amplified IgG heavy- and light-chain variable regions were sequenced on an Illumina MiSeq (600-base v3 kit; Illumina) and reads corresponding to the same plate/well location were combined into consensus sequences ...
-
bioRxiv - Immunology 2019Quote: ... Amplicon mixtures corresponding to 10:1 ratios of heavy chain + lambda: kappa were submitted for 300 forward × 250 reverse sequencing with MiSeq v3 kits (Illumina) at the Chan Zuckerberg Biohub Genomics Center ...
-
bioRxiv - Genetics 2020Quote: The phage L cII−101 genome was sequenced at the University of Pittsburgh by dideoxy chain termination methods as described (Pedulla, Ford et al. 2003) and at New England Biolabs by Illumina techology (above) ...
-
bioRxiv - Microbiology 2022Quote: ... followed by polymerase chain reaction with primers containing Illumina adapters to construct DNA libraries for paired-end sequencing on a NextSeq machine (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... They were then quantified by quantitative polymerase chain reaction (qPCR) and sequenced on a NextSeq500/550 System (Illumina, San Diego, CA, USA) according to the manufacturer instructions ...
-
bioRxiv - Immunology 2021Quote: ... and BCR IgG heavy chain loci were performed at Repertoire Genesis Incorporation (Osaka, Japan) using an unbiased amplification method with MiSeq (Illumina, San Diego, CA, USA). Data processing ...
-
bioRxiv - Microbiology 2022Quote: ... The latter was quantified by real-time quantitative reverse transcriptase-polymerase chain reaction and then sequenced on a Illumina MiSeq system with 2 × 250bp paired-end reads (Illumina Inc., San Diego, CA, USA) at the GeT-PlaGe Platform (Toulouse ...
-
bioRxiv - Neuroscience 2023Quote: ... biotin-labeled and directly hybridized to the Illumina HumanHT-12 v4.0 Expression BeadChip (47,231 probes) (Illumina, San Diego, CA, USA). Slides were scanned using the Illumina iScan and the signal was extracted and normalized using the GenomeStudio software ...
-
bioRxiv - Molecular Biology 2023Quote: ... The abundance of the guide RNAs in the T = 0 and T10 replicates was determined by Illumina Next Generation Sequencing ...
-
bioRxiv - Immunology 2021Quote: Single-cell antibody repertoire libraries were sequenced on an Illumina NovaSeq 6000 system (Illumina RTA Version: V3.4.4) using a 26 x 91 bp read configuration.
-
bioRxiv - Genetics 2019Quote: Sequencing libraries were prepared using the truseq Nano DNA sample preparation kit (T FC-121-4001/4002, Illumina Inc) extracting 100 ng DNA for each sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using the configuration 28-8-98 on a single-index-paired-end run ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Truseq-P5 hybrid constant oligo (IDT, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and Nextera N7XX indexing primer (Illumina, Inc., FC-131-1001). Final libraries (4nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... or conventional short read RNA-seq of fragmented cDNAs at 20 million (T) or 100 million (N) read depth (Illumina). Full length RNA-seq data were processed using the ToFU platform ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... RNA integrity was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA 95051 USA. mRNA was isolated using poly T beads, whereafter Illumina libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each library was prepared using Single Index Kit T Set A (cat: PN-1000213) and sequenced on the HiSeq4000 system (Illumina) using 100 bp paired-end run at a depth of 65-100 million reads ...
-
bioRxiv - Genetics 2024Quote: ... we aligned the corresponding short reads to the human reference GRCh38 using bwa mem23 (v 0.7.17-r1188; -t 48 -R “@RG\tID:1\tLB:lib1\tPL:ILLUMINA\tSM:
\tPU:unit1”). Next ... -
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Genetics 2024Quote: The process of library construction involved the purification of messenger RNA from total RNA using magnetic beads attached to poly-T oligos (TruSeq RNA Sample Prep Kit v2, Illumina Inc.). Subsequently ...
-
bioRxiv - Genomics 2020Quote: ... was prepared from total RNA from a testicular tissue sample of one BSW bull homozygous for the mutant T-allele at Chr6:58373887 using the Illumina TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA). The library was sequenced using an Illumina NovaSeq6000 instrument ...
-
bioRxiv - Developmental Biology 2022Quote: ... SP flow cell (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... BV2 cells were then single cell cloned and G3BP1 was sequenced by Illumina HiSeq ...
-
bioRxiv - Microbiology 2019Quote: ... BV-2 cells were then single cell cloned and G3BP1 was sequenced by Illumina HiSeq ...
-
bioRxiv - Cell Biology 2023Quote: ... performed on 24 cells/cell line using a NextSeq 500 (Illumina, San Diego, CA). Data analysis was performed as described previously69 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or S4 flow cell (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... 300 cycles flow cell (Illumina), with the following parameters ...
-
bioRxiv - Cancer Biology 2023Quote: ... or S4 flow cell (Illumina). The average number of read pairs per normal was 614 million and the average number of read pairs per tumor was 1.3 billion.
-
bioRxiv - Cancer Biology 2021Quote: ... Single cell derived cDNA libraries were sequenced on NovaSeq S4 cell sequencer (Illumina, San Diego, CA). Cellranger (10x Genomics ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were tagmented with TDE1 (Illumina) for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A MiSeq nano flow cell (Illumina) was clustered with a 4pM library comprised of 90% PhiX and 10% PCR-prepared library ...
-
bioRxiv - Genetics 2020Quote: ... 100 cycles flow cell (Illumina Inc.). Amplified fragmented cDNA of 300 bp in size were sequenced in single-end mode with a read length of 100 bp ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... loaded on a flow cell (Illumina) and sequenced on a NextSeq 500 platform (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... loaded on a flow cell (Illumina) and sequenced on a HiSeq 4000 platform (Illumina ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and analyzed using Cell Ranger (Illumina).
-
bioRxiv - Developmental Biology 2024Quote: ... 150 cycles flow cells (Illumina, 20024907). Library preparations of one sample per genotype were run on a single flow cell ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were submitted for 10x library preparation for 3’ single cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute ...