Labshake search
Citations for Illumina :
1 - 50 of 2106 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... using Qiagen RNeasy Plus kit.200ng of extracted RNA was used to produce SARS-CoV-2 amplicon libraries using the NEBNext SARS-CoV-2 FS Library Prep Kit (Illumina) using the VarSkip Short Express Protocol with 25 minutes fragmentation step and 8 cycles of PCR enrichment ...
-
bioRxiv - Genomics 2020Quote: ... with the respiratory virus oligo panel including SARS-CoV-2 probes (Illumina, San Diego ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina). SARS-CoV-2 whole-genome amplicon-based sequencing was conducted by adapting an existing whole genome sequencing pipeline for poliovirus genotyping as described (Wang et al. ...
-
bioRxiv - Microbiology 2021Quote: All SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Molecular Biology 2022Quote: The whole genome sequencing of SARS-CoV-2 was performed on MiSeq System (Illumina technology), that is installed at R’VRDL ...
-
bioRxiv - Microbiology 2022Quote: ... The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina) workflow was used in genetic variant analyses ...
-
bioRxiv - Microbiology 2020Quote: ... At Gdansk two independent protocols were used for SARS-CoV-2 genome sequencing: Illumina RNA prep with enrichment for respiratory virus oligos panel V2 followed by Illumina MiniSeq medium output run that produced 150-nucleotide paired-end reads ...
-
bioRxiv - Immunology 2022Quote: ... a multiplexed amplicon-based whole-viral-genome approach using the NEBNext® ARTIC SARS-CoV-2 Library Prep Kit (Illumina®) was employed (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation of amplified SARS-CoV-2 DNA for sequencing was performed using a Nextera XT library prep kit (Illumina Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... Library preparation of amplified SARS-CoV-2 DNA for sequencing was performed using a Nextera XT library prep kit (Illumina Inc.) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... DNA fragments of the SARS CoV-2 genome were hybridized with biotinylated respiratory virus oligos (Illumina Inc., San Diego, CA, USA). The DNA fragments hybridized with the custom oligos were captured using streptavidin magnetic beads ...
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina FC-110-3001).
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina, FC-110-3001).
-
bioRxiv - Immunology 2021Quote: ... commercial reagents were used for unique dual indexed amplicon library generation according to the Artic protocol (NEBNext® ARTIC SARS-CoV-2 Library Prep Kit (Illumina®)) ...
-
bioRxiv - Microbiology 2022Quote: ... and variant calling as described by the software manufacturer (https://help.geneious.com/hc/en-us/articles/360045070991-Assembly-of-SARS-CoV-2-genomes-from-tiled-amplicon-Illumina-sequencing-using-Geneious-Prime). For each sample ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was amplified using ARTIC v4 primer pools (https://github.com/artic-network/artic-ncov2019) and variant calling results were generated using the SIGNAL (SARS-CoV-2 Illumina GeNome Assembly Line) pipeline v1.5.0 42 ...
-
bioRxiv - Genomics 2023Quote: ... and combined with 50% PhiX spike-in control (Illumina, Cat# FC-110-3001). Single-end 300mer sequencing was then performed on a MiSeq platform (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... which included a 1% PhiX spike (PhiX Control v3; Illumina Catalogue FC-110-3001). The data was uploaded to BaseSpace (http://www.basespace.illumina.com ...
-
bioRxiv - Genetics 2023Quote: ... A 10% spike-in of PhiX control V3 (#FC-110-3001; Illumina, San Diego, CA) was added to these amplicons ...
-
bioRxiv - Neuroscience 2022Quote: ... with a 20% v/v PhiX Control v3 spike-in (Illumina, Cat. No. FC-110-3001) and sequenced on Illumina’s NovaSeq 6000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were then tagmented using the Illumina/Nextera DNA prep kit (FC 121-1030) with index tags from Illumina (FC 121-1031), cleaned up with Ampure XP beads ...
-
bioRxiv - Synthetic Biology 2023Quote: The sequencing libraries were mixed with 20–30% of PhiX spike-in DNA control (Illumina #FC-110-3001) for better cluster generation on the flow cell and sequenced by Illumina MiSeq (MiSeq v3 150-cycles kit #MS-102-3001 or 300-cycles kit #MS-102-3003) ...
-
bioRxiv - Genetics 2020Quote: ... 2×150 cycles (Illumina, cat. FC-420-1004), or a Nextseq 500 V2 Mid Output kit ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Genomics 2020Quote: ... and pooled in equal concentrations prior to MiSeq v3 sequencing with 15% phiX control spike-in (Illumina FC-110-3001).
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 12 pM loading concentration with 10% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Genomics 2019Quote: ... single-end mode) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Microbiology 2023Quote: ... All sequencing runs were performed with a spike-in of 1% PhiX control library V3 (Illumina, Cat. FC-110-3001). The sequencing mean library size was 134,629,540.5 reads [range ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired-end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Genomics 2021Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike (PhiX Control v3 Illumina Catalogue FC-110-3001).
-
bioRxiv - Genomics 2022Quote: ... Illumina Catalogue FC-404-2003) following the Illumina recommended denaturation and loading recommendations which included a 1 % PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Data was uploaded to Basespace (www.basespace.illumina.com ...
-
bioRxiv - Genetics 2019Quote: ... 1% PhyX spike-in (Illumina) was included ...
-
bioRxiv - Systems Biology 2022Quote: ... 1% PhyX spike-in (Illumina) was added then pooled ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplicons were generated from the plasmids using primer pairs oKAC1589/oKAC1590 (for the catalytic domain) or oKAC1591/oKAC1592 (for the PI domain) and sequenced on a MiSeq (Illumina) to a depth of 12,378 and 409,221 reads for the catalytic and PI domain libraries ...
-
bioRxiv - Cancer Biology 2023Quote: ... adding 10% PhiX spike-in (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Nextera XT indices were used to generate libraries from 1 ng of cDNA material for each sample following the instructions provided by Illumina (Illumina FC-131-1096 and FC-131-2001). Library preparations were purified using AMPure XP beads and checked for quality using the Agilent Bioanalyzer at Stanford Functional Genomics Facility (SFGF) ...
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and dual-indexed with Nextera XT Index Kit V2 Sets A-D (FC-131-2001, FC-131-2002, FC-131-2003, FC-131-2004, Illumina, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Two Nextseq runs were performed to compile enough reads (19-32 million pass-filter reads).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequencing was carried out with a NovaSeq 6000 SP 2×100bp FlowCell plus PhiX spike-in (Illumina, US), outputting ∼25M read pairs/sample ...
-
bioRxiv - Neuroscience 2021Quote: ... or PhiX bacteriophage (Illumina spike-in control) sequences ...