Labshake search
Citations for Illumina :
1 - 50 of 504 citations for Recombinant Human Lectin Galactoside Binding Soluble 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Molecular Biology 2020Quote: ... The forward primer included a P5 sequence (for binding the Illumina flow cell) followed by a Illumina sequencing primer binding site ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reverse primer included a P7 sequence (for binding the Illumina flow cell) followed by a 6-nt i7-index sequence ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... reverse-transcribed using random hexamer primers that introduce Truseq Small RNA kit RP1 primer binding sites (Illumina) and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index ...
-
bioRxiv - Genomics 2021Quote: ... platform = c(”Illumina Human Methylation 450”), and sample.type = c(”Primary solid Tumor”,”Solid Tissue Normal”) ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2021Quote: ... four human CNV membranes and four human RPE-choroidal control tissues) were sequenced on the NextSeq 500 (Illumina) with 1 × 75 bp ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The resultant recombinants containing known donor barcodes and unknown recipient barcodes were sequenced by Illumina MiSeq platform ...
-
bioRxiv - Genomics 2021Quote: BD Infinium Human Methylation 450 arrays (Illumina) were retrieved from the European Genome-phenome Archive (EGA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was done with Illumina NextSeq 500 using NextSeq 500/550 High Output Kit v2.5 for HeLa samples and with Illumina NovaSeq 6000 using partial S4 flow cell lane for patient samples.
-
bioRxiv - Neuroscience 2022Quote: ... A Human OmniExpress v1.2 BeadChip array (Illumina) was used post-editing to check for any gross karyotype abnormalities ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Microbiology 2023Quote: ... second BsmBI site (producing cut-edge between the base pairing region and dCas9 handle binding region) and read2 (Illumina sequencing element) was amplified from pPEPZ-sgRNAclone (Addgene# 141090 ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2020Quote: ... Human libraries were sequenced on a NovaSeq 6000 (Illumina) and mouse libraries on a NextSeq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression log intensity levels (Illumina Human v3 microarray) were used as the expression levels of the genes ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and g2997a) at the forward primer binding site used in the ‘round 1 PCR’ step below (the step attaching partial Illumina sequencing adaptors), thus excluding PCR amplification of the competitor viruses during sequencing library preparation such that only the library viruses ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...